SNPJam Report for gpt

Showing coding SNPs for GPT (Gene ID: 2875)

Show all SNPs for this gene at dbSNP

This SNP viewer is in beta and your feedback is appreciated!

This SNPJam view is a snapshot of the information available at dbSNP and HapMap. It has been reformated to include the information most relevant to drug and metabolomics research.

Please note that population frequency data is updated on a nightly basis and may not be present if this gene was recently annotated.

Show all non-coding SNPs

[Top]

RS ID: 1063739 Link_out

Alleles: A/C

Validation:

  • By cluster
  • By frequency
  • By 2 hit 2 allele
  • By hap map

Details:

Chromosome Reference Position
8 145729727

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_005309 Link_out NP_005300 Link_out 1 H [His] / N [Asn]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-ACCCACTGCCTCTGCCTCCCTGGGGCAGAGCTGTTCCCAGACGGGTGGGGCGGGGCCCAACTGTCCCCAGCTCCTTCAGCCCTTTCT
GTCCCTCCCAGTGAGGCCAGCTGCGGTGAAGAGGGTGCTCTCTTGCCTGGAGTTCCCTCTGCTACGGCTGCCCCCTCCCAGCCCTGGCCC
ACTAAGCCAGACCCAGCTGTCGCCATTCCCACTTCTGGTCCTGCCACCTCCTGAGCTGCCTTCCCGCCTGGTCTGGGTAGAGTCATGGCC
TCGAGCACAGGTGACCGGAGCCAGGCGGTGAGG A/C ATGGACTGAGGGCGAAGGTGCTGACGCTGGACGGCATGAACCCGCGTGTGCG
GAGAGTGGAGTACGCAGTGCGTGGCCCCATAGTGCAGCGAGCCTTGGAGCTGGAGCAGGAGCTGCGCCAGGTATGGCCCAGGGCCCCTCG
CTGCCCTCCAGGTCACAATGGGGTGGCCGAGTTGGCCCCAGCCCCACTGGCACATGGGACAAGGGCTGAGGGGTTAGGTAGGGCACAGTC
TCCCTGCCTGCTCCCCTCCCCTCCCAGGGTGTGAAGAAGCCTTTCACCGAGGTCATCCGTGCCAACAT-3'