SNPJam Report for SPTLC3

Showing coding SNPs for SPTLC3 (Gene ID: 55304)

Show all SNPs for this gene at dbSNP

This SNP viewer is in beta and your feedback is appreciated!

This SNPJam view is a snapshot of the information available at dbSNP and HapMap. It has been reformated to include the information most relevant to drug and metabolomics research.

Please note that population frequency data is updated on a nightly basis and may not be present if this gene was recently annotated.

Show all non-coding SNPs

[Top]

RS ID: 112329671 Link_out

Alleles: A/G

Validation:

  • By cluster

Details:

Chromosome Reference Position
20 12990024

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_018327 Link_out NP_060797 Link_out 1 E [Glu] / K [Lys]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AGAGCTTTATCCCATCCCCTCGCAGACTGAAAACTAAAGCCTGCAGAGACCTCTGAAGGAAAACCTGTCCCGGGCTCTGTCACTTCA
CACCCATGGCTAACCCTGGAGGTGGTGCTGTTTGCAACGGGAAACTTCACAATCACAAGAAACAGAGCAATGGCTCACAAAGCAGAAACT
GCACAAAGAATGGAATAGTGAAG A/G AAGCCCAGGTAAGAGGCACTCTCCCCTACTCTTCTCTGAATTACCTGAACGTTTCAATATTT
CTCTGTGAAGATATTTGAGGCTGTCCTAACTTAGAGTTCATCTTATGAAGGGTTTTTACATGTTTTGACTGTTGACTCTGTTAATAGAAA
GTGCTTGGCTACCAAAAAGTTTAGGTGTGGATTAAGGAGAAAATGTCT-3'

[Top]

RS ID: 75310104 Link_out

Alleles: C/T

Validation:

  • By cluster

Details:

Chromosome Reference Position
20 13098176

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_018327 Link_out NP_060797 Link_out 2 L [Leu] / P [Pro]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AAATGCCCAAGTGGCCTTACAAGATTGAAAGGGTTGTCTCAGCCAAATAAAACATGCCTTCAGAACAAAGGAATGGCGTGTGTCAGG
GAAGACTGTCTAGGATGTATTGATGGGGAAACTGACAGAGCTTCCCAGGAGGGTATTTGTTAGTTATGAGCATTTCTCCTTCTGCCCTAG
CATGGAAGGTTCCATCGTGCATC C/T GCCCCAGATCATAGCTCTAAAGAAGAAATACAAGGCTTACCTCTACATAGATGAAGCTCACA
GTATTGGGGCCGTGGGCCCAACCGGCCGGGGTGTCACGGAGTTCTTTGGACTAGACCCTCATGAAGTTGATGTGCTCATGGGCACATTCA
CCAAAAGTTTTGGAGCTTCAGGAGGTTACATAGCTGGAAGGAAGGTAA-3'

[Top]

RS ID: 61746220 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
20 13090819

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_018327 Link_out NP_060797 Link_out 2 R [Arg] / H [His]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CCTAGAGAAGCTCCTGAGAGATGCTGTCATCTATGGCCAGCCTCGAACCC A/G CAGAGCTTGGAAAAAGATTCTCATCCTGGTGG
AGGGTGTCTACAGGTATG-3'

[Top]

RS ID: 61738161 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
20 13140720

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_018327 Link_out NP_060797 Link_out 1 A [Ala] / T [Thr]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TAGAGAAAAAAATTGGAGTGGTGGTCGTGGGATTTCCAGCCACTCCCCTC A/G CAGAAGCTCGGGCTCGGTTTTGTGTTTCAGCG
GCACATACCCGGGAGATG-3'

[Top]

RS ID: 61738160 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
20 13055027

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_018327 Link_out NP_060797 Link_out 3 I [Ile] / I [Ile]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-ATTTACATGTTTCCCCACAGGTTTACTGGAAGAGTCATCAAAGATGTCAT C/T AACATGGGCTCCTATAACTTCCTTGGTCTTGC
AGCCAAGTATGATGAGTC-3'

[Top]

RS ID: 6109735 Link_out

Alleles: A/G

Validation:

  • By hap map

Details:

Chromosome Reference Position
20 13140708

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_018327 Link_out NP_060797 Link_out 1 A [Ala] / T [Thr]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GATGGATTTTATATCACTGCAGATTTGTTAAACCAGAGTCATAAACATCAGCATTTTCTGCTTGGTGTCAAAGACTCAATATCCACA
ATTATCTAATGAGTGTGTCAGACCCATAATACCACACACACACCATCATGAGTGGCACCAAGTGACTGACTGCCTGTTTATTTGTCAATT
TTATTTGACAGAAGTTTAAAAACTTCAATCATCTTCCACTTATTATCATAAAAAAGAAAAAAGAAAAAAGAAAAAATCAATTAGCCATAT
TCCTTTTTTGTCAGGATAATTTTGTCTTTTCCCAACTAACCACTTTTTTTTTTTCTTTTTTTGCTTTTCCTTAAGGGCTTTTGCAAGGCA
TATGCTAGAGAAAAAAATTGGAGTGGTGGTCGTGGGATTTCCA A/G CCACTCCCCTCGCAGAAGCTCGGGCTCGGTTTTGTGTTTCAG
CGGCACATACCCGGGAGATGTTAGACACGGTGAGTACACCACAGGCCAACGGGATCTCAGTACCAGTACCTTGGATTCAAAGCAAGTCCT
TTTGTTGAGACAGCTTGGGGTTCTCTGGGTTTCTCTTGGGTTATTTAGGAAAACAACACTGACAAAAGTCACTGCCAAAAAACAAGAGCT
CGTCAACAACAGCCAACACTGTGACCACTCAGTAGATAGAAATGAAAATCAGTTTAGTGAAGATTTCAATCAGTGTTTTGGTTTCCTACA
AAAGACTGACTGAGTAGCCAAATGTTCTTCTATTTACTTGATCTTAAATGCAAAAGCTGGTCTAAAATGCTGTTTTAGACTTAATTAC-3
'

[Top]

RS ID: 6109692 Link_out

Alleles: C/T

Validation:

  • By cluster
  • By frequency
  • By 2 hit 2 allele
  • By hap map

Details:

Chromosome Reference Position
20 13071816

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_018327 Link_out NP_060797 Link_out 3 F [Phe] / F [Phe]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AATTGTGGGGTTTTTTTGTAAATTATATTTCATTTACAGCATGGTgaaaagtgcaccagtcataggtatacagctcaatggatctcc
acaaagcaaacatacctatgtaacaaatgcagaaatagaacattcagagaatctaaaaaccatcctcatgctcctaacaaaagtaactac
tatcctgacttctaacactgcagatctgttttgtctggttgcatattttatgtaaacgaaatgatacagcctgtacttttttagatgtct
gacttttttcactcaacaacagatttgtgagatttatccacaatgttgtgtggagcagtagttcattctttctcattgctgtattgaatt
ccactgtataaataccccacattgtatttttccattctacaatagttgaatatttgggctgtttctagattagggcaatggcaaatcttc
ctgctacaagcactcttgtataggtcttttggtgatgtgtacgtactGGAATTTGAGTTTTCAATCTTGGCCTTGTTGAAAAGAGAAGGC
TCACTTCTCATGTAATTTTATGTGCAGGCACCTTGGATAAGCACAAGGAGTTGGAGGACCTTGTGGCTAAGTTCCTGAATGTGGAAGCAG
CTATGGTCTTTGGGATGGGATT C/T GCAACTAACTCAATGAATATCCCAGCATTAGTTGGAAAGGTGAGAATTGTTAACCTAATTGTC
TTCTACTGTATTACTCCTAAGAACTGTAACTCTGAGTAGGTCCTTGTTAGAAGTATGGCTGAGATgggcacggtggttcacgcctgtaat
cctagcactttgggagcccaaggcgggcggatcacgaggtcaagagacctagatcatcctggccaacatagtgaaaccccgtctctacta
aaaataaaaaagttacctgggcatggtggcacgcacctgtagtcccagctacttgggaggctaaggcaggagaattgcttgaacccagga
agtggaggttgcaatgagccgagatcgggccactgcactctagcctggtgacagagtgagactctgtctcaaaaaaaaaaaaagaaaaaa
agaagaaGTATGGCTGAGAAGGTTCTTTTCGTAGGAGAAACTGATTGGATATTGGTATTTTTGAATAAGTATGCCAGCT-3'

[Top]

RS ID: 6078938 Link_out

Alleles: C/T

Validation:

  • By frequency
  • By cluster

Details:

Chromosome Reference Position
20 13134768

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_018327 Link_out NP_060797 Link_out 3 Y [Tyr] / Y [Tyr]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-ACCTCCCCTGCCTCCCACCAGCCCTCTAGCGTATCCTGGCTTCAGTTGCTTGCAGCACCTCGTAGAACCCTCCACCTCCCTTCCTGC
CTTCCAGGTGCAAGGTAGTACCTGGGCATCAGTGCCCACACCTGCTCCCCAGGAGATATCTCCCTTCCCTACTTCCTCCTCCCAGCTAGT
GCTGCTGGCCTGCAGAAAGACTTAAAGATGCTTGCCAAGTTGACCGGACCTTTACTTCCCTCTTTCTAGTGGGAATTGATGGATTTCACG
CCTGTCTCTTTTCAGGGCTGCAGAGAGTACAGCAACTTGCGAAAAACACAAGATACTTCAGACAAAGACTGCAGGAAATGGGATTCATTA
TCTATGGCAATGAGAATGCTTCTGTTGTTCCTCTGCTTCTTTA C/T ATGCCTGGTAAAGTAGCGTAAGTATCCAAGGCATCTCATAAT
CACACCTAAACCCCAAGGTGACCTAAGATGGCTTTTTGGCACAGGCGTTAGATTATGCATCTGGAATGGGGTGAGTGAGTTCAGAATTCA
CTCGTACGGCTTCTCGGAAGCCACCTGTCACTCTATCAGCTAGACCCTTCCCACAGGTCTTATAGAAAGGGAACCAAAGGTGCTGAGACT
GAGCTCTCTCCCTAAATTCAAGTTCTGTGAATTTAGGGAAATCACTTATCTCCCTCAGCCTCACCTGTAAATTAAGCACAATCCTGAGCC
TCCTTCTGACCCAAGATCGTTCTCAGGGAGAACTTCTGAAGATCATCTCTCCCCATATTACCATAAAAACAATGTGATCAGGCTCTGT-3
'

[Top]

RS ID: 6074550 Link_out

Alleles: C/T

Validation:

  • By cluster

Details:

Chromosome Reference Position
20 13029674

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_018327 Link_out NP_060797 Link_out 1 Y [Tyr] / H [His]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TAACGACCCCAAGtttgtgattaggaagtaagctgtggggtcatactttagcaacttgcaaacactctgttcctcattaactcttca
cccaatggtttgagtttctgttgagaacttttgcttgaatcaattatgttactatggcttgtaaaatAAAGTTTGCATTTTTGATTACCC
TCTTCAATGGTCAGTTTCTAATTTATTTACAATCTTAAATATGGCCTTTGGAATTCAAAGGGTTGAAAGTTCACAATTTTAGGTATCATA
GTATATCTGTAACAGGAGAATGCTAACCTTGGATTTTCTTTTGTGTTTTCAGCAAAATGGGAAGCCACATTTTTATGATAAGCTCATTGT
TGAATCGTTTGAGGAAGCACCCCTTCATGTTATGGTTTTCACT C/T ACATGGGATATGGAATTGGAACCCTGTTTGGCTATCTCAGAG
ACTTTTTAAGAAACTGGGGAATAGAAAAATGCAACGCAGCTGTGGAAAGAAAAGAACAAAAAGTACGTATGCGCACCTCCCTGGATCTTT
GTCAATGCCTACTCCTCTCTAAAGTGTTCTCAGAAGTGGTGATGCAGGTGCAGATCCTAGAAAGCATGAGGTGCTCAGGAACTATTCAGG
GCAAATTTCATTCATCTCCACCTCCTAAACCCCATTACCCATGGGCTTATGGACCTGTTTTTACAAACATCTCATGGGCAACTACTATTT
GCCACATACCAAACTAAGGCTTTTCCCATACCTTGTAATATTTAATTTTTGTAACAACCCCATGATATAGATATTAAACTATAATTTT-3
'

[Top]

RS ID: 2295383 Link_out

Alleles: A/C

Validation:

  • By hap map

Details:

Chromosome Reference Position
20 13074143

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_018327 Link_out NP_060797 Link_out 1 L [Leu] / V [Val]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TGGTTGCACCTGAGAGTCGGGCCCCAAGCACAAGCGATGTGTGGTTTAACTCATCACTTA A/C AATGAGGCATCCCTGTGCAGAA
AACAAGCACACAAAACACAAGCCAATAAATAAAACCAA-3'

[Top]

RS ID: 1431433 Link_out

Alleles: G/T

Validation:

  • By frequency
  • By hap map
  • By cluster

Details:

Chromosome Reference Position
20 13029764

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_018327 Link_out NP_060797 Link_out 1 R [Arg] / R [Arg]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AGCATAAATAATACCCAACTTACAACTAGAAGACCAAAGTACAGTCCCACCCAGGAGCACTTGCTTTTATATTTTGATGTTTTTATC
TTCAAAATTATAGTTTAATATCTATATCATGGGGTTGTTACAAAAATTAAATATTACAAGGTATGGGAAAAGCCTTAGTTTGGTATGTGG
CAAATAGTAGTTGCCCATGAGATGTTTGTAAAAACAGGTCCATAAGCCCATGGGTAATGGGGTTTAGGAGGTGGAGATGAATGAAATTTG
CCCTGAATAGTTCCTGAGCACCTCATGCTTTCTAGGATCTGCACCTGCATCACCACTTCTGAGAACACTTTAGAGAGGAGTAGGCATTGA
CAAAGATCCAGGGAGGTGCGCATACGTACTTTTTGTTCTTTTC G/T TTCCACAGCTGCGTTGCATTTTTCTATTCCCCAGTTTCTTAA
AAAGTCTCTGAGATAGCCAAACAGGGTTCCAATTCCATATCCCATGTAAGTGAAAACCATAACATGAAGGGGTGCTTCCTCAAACGATTC
AACAATGAGCTTATCATAAAAATGTGGCTTCCCATTTTGCTGAAAACACAAAAGAAAATCCAAGGTTAGCATTCTCCTGTTACAGATATA
CTATGATACCTAAAATTGTGAACTTTCAACCCTTTGAATTCCAAAGGCCATATTTAAGATTGTAAATAAATTAGAAACTGACCATTGAAG
AGGGTAATCAAAAATGCAAACTTTATTTTACAAGCCATAGTAACATAATTGATTCAAGCAAAAGTTCTCAACAGAAACTCAAACCATT-3
'

[Top]

RS ID: 243888 Link_out

Alleles: C/T

Validation:

  • By cluster
  • By frequency
  • By 2 hit 2 allele
  • By hap map

Details:

Chromosome Reference Position
20 13053035

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_018327 Link_out NP_060797 Link_out 3 S [Ser] / S [Ser]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CATGCTCTGGTTTAAATTCTAGCAAGAGCCTTCCAGAAGAACAAGAACCATGGTCATCACTGTCTCATTCAGCTGTAAGTAGGAGAG
TAGAATTTGTCAATAAAGCTGAAAGGTGTCTTCCTGGCTGGCTTGGTGTGTCCTGCACCTTCTGACCCAGGTCTTAGGTTAATTACAATA
CAAAAAAGCCACTCTGGCAGCTGCTTGATTACTTTACTGTGCCTTCCTCCCCTGGCATCAGGAGGGCTTGCAAAGGCATAAATGATACAA
AACCAATGGCTTCCATGCCTTGTTTTTTTGGATTTGTCATCTAGTGGCCATGCTAGGATTTCCTTGAAAGGTTTTTCTTTTCACCAATCC
CCTCCAAGAAGTTCTCTCACCTAAACGTCCAGTTATAGTCGTC C/T GATACCCTCTCCATCAAATCAAACAGAGGCCCTGGGGCACTG
CAGATGGGCCGGTTCCAGTTGTCTCTGATTCGCATGTAAAGGTTTCTTGTATAAAAATTTTCAAAGTCTTGATACAGTGGCACAAAATCC
TGTTAGAACAGAGGTAGAAGGTTATCTCTGGTTCTTTGCTTTCTGGATTTCACTTACAATTGAAGCAGGGAAGAAGACCTGGAAGAGCTG
TGGAAATAACACATCTACAGATATATTTTGAGCAAAGGTCAGTAGGTGAGGGAAGTAAATCTGTGAGGCTAAAGAACATGCCTTTTAGTG
GGGGAATGAAAACATGTGATGAACAGGGGTAACAAAGATGTCAGTGCAATACAAGCCCGAAAGCAAGTGGAGACAACACGTCCCTGCA-3
'

[Top]

RS ID: 243887 Link_out

Alleles: A/C

Validation:

  • By cluster
  • By frequency
  • By 2 hit 2 allele
  • By hap map

Details:

Chromosome Reference Position
20 13053018

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_018327 Link_out NP_060797 Link_out 1 L [Leu] / V [Val]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TCTAGCAAGAGCCTTCCAGAAGAACAAGAACCATGGTCATCACTGTCTCATTCAGCTGTAAGTAGGAGAGTAGAATTTGTCAATAAA
GCTGAAAGGTGTCTTCCTGGCTGGCTTGGTGTGTCCTGCACCTTCTGACCCAGGTCTTAGGTTAATTACAATACAAAAAAGCCACTCTGG
CAGCTGCTTGATTACTTTACTGTGCCTTCCTCCCCTGGCATCAGGAGGGCTTGCAAAGGCATAAATGATACAAAACCAATGGCTTCCATG
CCTTGTTTTTTTGGATTTGTCATCTAGTGGCCATGCTAGGATTTCCTTGAAAGGTTTTTCTTTTCACCAATCCCCTCCAAGAAGTTCTCT
CACCTAAACGTCCAGTTATAGTCGTCTGATACCCTCTCCATCA A/C ATCAAACAGAGGCCCTGGGGCACTGCAGATGGGCCGGTTCCA
GTTGTCTCTGATTCGCATGTAAAGGTTTCTTGTATAAAAATTTTCAAAGTCTTGATACAGTGGCACAAAATCCTGTTAGAACAGAGGTAG
AAGGTTATCTCTGGTTCTTTGCTTTCTGGATTTCACTTACAATTGAAGCAGGGAAGAAGACCTGGAAGAGCTGTGGAAATAACACATCTA
CAGATATATTTTGAGCAAAGGTCAGTAGGTGAGGGAAGTAAATCTGTGAGGCTAAAGAACATGCCTTTTAGTGGGGGAATGAAAACATGT
GATGAACAGGGGTAACAAAGATGTCAGTGCAATACAAGCCCGAAAGCAAGTGGAGACAACACGTCCCTGCAGTTTCTCTAAGGGTAAC-3
'