SNPJam Report for SLC25A2

Showing coding SNPs for SLC25A2 (Gene ID: 83884)

Show all SNPs for this gene at dbSNP

This SNP viewer is in beta and your feedback is appreciated!

This SNPJam view is a snapshot of the information available at dbSNP and HapMap. It has been reformated to include the information most relevant to drug and metabolomics research.

Please note that population frequency data is updated on a nightly basis and may not be present if this gene was recently annotated.

Show all non-coding SNPs

[Top]

RS ID: 115876844 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
5 140683242

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_031947 Link_out NP_114153 Link_out 2 Y [Tyr] / C [Cys]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TCACAAGCTCAGTGGGGCAGAGAGCCAGTGCAGCAAATGCAGAGGCGAAGGACCCCGCGGCTGCAGTCTGGAGATCACTCAGCTTTG
CCTGCTTGTCCATTCCAGCCACTTTCCTGACAAACTGCTGGCAGAACCCGTAGCACATGAAGAGGACCGAGTTTTCGGCGACGTAGGCCA
TAAGTGCCGGGCCGGTGCCCTTG C/T AGAAGCCCCGGAGACCCACTTGGGCGTATGTCTTCAGGAAGCAGTCGGTGAGGCCCTTGTAC
AGGTCAGGGAACGTCTGCATCTTCACTTTTATTGTGTCGAAGGGCTGCCCAGTCAGTACACACGCTGTCCCCCCTGCGGCCCCCGCTGTG
AGGTCGATGGCGGCTTGGATGCCAGGACCGGACTTCATGTTCGCTCAC-3'

[Top]

RS ID: 79139730 Link_out

Alleles: C/T

Validation:

  • By frequency

Details:

Chromosome Reference Position
5 140683142

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_031947 Link_out NP_114153 Link_out 3 G [Gly] / G [Gly]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TCCTTTTTAAGGATACCCTTCACGACAGACCAAATTGTATTATGGCTTTTTGCTATCTTCCCTGACATCTCCATTTCATACATGGTC
TGTAGCCGGCACTTCACAAGCTCAGTGGGGCAGAGAGCCAGTGCAGCAAATGCAGAGGCGAAGGACCCCGCGGCTGCAGTCTGGAGATCA
CTCAGCTTTGCCTGCTTGTCCAT C/T CCAGCCACTTTCCTGACAAACTGCTGGCAGAACCCGTAGCACATGAAGAGGACCGAGTTTTC
GGCGACGTAGGCCATAAGTGCCGGGCCGGTGCCCTTGTAGAAGCCCCGGAGACCCACTTGGGCGTATGTCTTCAGGAAGCAGTCGGTGAG
GCCCTTGTACAGGTCAGGGAACGTCTGCATCTTCACTTTTATTGTGTC-3'

[Top]

RS ID: 34663948 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
5 140682993

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_031947 Link_out NP_114153 Link_out 2 A [Ala] / V [Val]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TCACCGACTGCTTCCTGAAGACATACGCCCAAGTGGGTCTCCGGGGCTTCTACAAGGGCACCGGCCCGGCACTTATGGCCTACGTCG
CCGAAAACTCGGTCCTCTTCATGTGCTACGGGTTCTGCCAGCAGTTTGTCAGGAAAGTGGCTGGAATGGACAAGCAGGCAAAGCTGAGTG
ATCTCCAGACTGCAGCCGCGGGGTCCTTCGCCTCTGCATTTGCTGCACTGGCTCTCTGCCCCACTGAGCTTGTGAAGTGCCGGCTACAGA
CCATGTATGAAATGGAGATGTCAGGGAAGATAG C/T AAAAAGCCATAATACAATTTGGTCTGTCGTGAAGGGTATCCTTAAAAAGGAT
GGCCCCTTGGGCTTCTACCATGGACTCTCGAGTACTCTACTTCAAGAAGTACCGGGTTATTTCTTTTTCTTTGGTGGCTATGAACTGAGC
CGATCGTTTTTTGCGTCAGGGAGATCAAAAGATGAACTAGGCCCTGTCCATTTGATGTTAAGTGGTGGAGTTGCTGGAATTTGCCTGTGG
CTTGTCGTGTTCCCAGTGGATTGTATTAAATCCAGAATTCAAGTTCTTTCCATGTATGGGAAACAGGC-3'

[Top]

RS ID: 11952797 Link_out

Alleles: A/G

Validation:

  • By frequency
  • By hap map
  • By cluster

Details:

Chromosome Reference Position
5 140683265

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_031947 Link_out NP_114153 Link_out 3 A [Ala] / A [Ala]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GACAGACCAAATTGTATTATGGCTTTTTGCTATCTTCCCTGACATCTCCATTTCATACATGGTCTGTAGCCGGCACTTCACAAGCTC
AGTGGGGCAGAGAGCCAGTGCAGCAAATGCAGAGGCGAAGGACCCCGCGGCTGCAGTCTGGAGATCACTCAGCTTTGCCTGCTTGTCCAT
TCCAGCCACTTTCCTGACAAACTGCTGGCAGAACCCGTAGCACATGAAGAGGACCGAGTTTTCGGCGACGTAGGCCATAAGTGCCGGGCC
GGTGCCCTTGTAGAAGCCCCGGAGACCCACTTG A/G GCGTATGTCTTCAGGAAGCAGTCGGTGAGGCCCTTGTACAGGTCAGGGAACG
TCTGCATCTTCACTTTTATTGTGTCGAAGGGCTGCCCAGTCAGTACACACGCTGTCCCCCCTGCGGCCCCCGCTGTGAGGTCGATGGCGG
CTTGGATGCCAGGACCGGACTTCATGTTCGCTCACTCGTCTGAGGGTCCCAGTGGAAGGCGACTAACTCCCCAGAGCGTGAGACCGGCTT
TTCACGTCCAGCCGCAGCGAGCGCGGGGAATGGAGTTGGGGGTGGTGGGGTGGCTCTACCGCCTGTTC-3'

[Top]

RS ID: 10075302 Link_out

Alleles: A/C

Validation:

  • By frequency
  • By cluster

Details:

Chromosome Reference Position
5 140682958

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_031947 Link_out NP_114153 Link_out 1 G [Gly] / C [Cys]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TTCTCACAACACTTAAGAGGGTACCAATAAATCCTGCCTGTTTCCCATACATGGAAAGAACTTGAATTCTGGATTTAATACAATCCA
CTGGGAACACGACAAGCCACAGGCAAATTCCAGCAACTCCACCACTTAACATCAAATGGACAGGGCCTAGTTCATCTTTTGATCTCCCTG
ACGCAAAAAACGATCGGCTCAGTTCATAGCCACCAAAGAAAAAGAAATAACCCGGTACTTCTTGAAGTAGAGTACTCGAGAGTCCATGGT
AGAAGCCCAAGGGGCCATCCTTTTTAAGGATAC A/C CTTCACGACAGACCAAATTGTATTATGGCTTTTTGCTATCTTCCCTGACATC
TCCATTTCATACATGGTCTGTAGCCGGCACTTCACAAGCTCAGTGGGGCAGAGAGCCAGTGCAGCAAATGCAGAGGCGAAGGACCCCGCG
GCTGCAGTCTGGAGATCACTCAGCTTTGCCTGCTTGTCCATTCCAGCCACTTTCCTGACAAACTGCTGGCAGAACCCGTAGCACATGAAG
AGGACCGAGTTTTCGGCGACGTAGGCCATAAGTGCCGGGCCGGTGCCCTTGTAGAAGCCCCGGAGACC-3'

[Top]

RS ID: 3749781 Link_out

Alleles: C/T

Validation:

  • By cluster

Details:

Chromosome Reference Position
5 140682674

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_031947 Link_out NP_114153 Link_out 3 L [Leu] / L [Leu]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TAAATCCAGAATTCAAGTTCTTTCCATGTATGGGAAACAGGCAGGATTTATTGGTACCCT C/T TTAAGTGTTGTGAGAAATGAAG
GAATAGTAGCCTTATATTCTGGACTGAAAGCTACTATG-3'

[Top]

RS ID: 3749780 Link_out

Alleles: A/G

Validation:

  • By frequency
  • By cluster

Details:

Chromosome Reference Position
5 140682757

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_031947 Link_out NP_114153 Link_out 1 V [Val] / F [Phe]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CCCACTGAGCTTGTGAAGTGCCGGCTACAGACCATGTATGAAATGGAGATGTCAGGGAAGATAGCAAAAAGCCATAATACAATTTGG
TCTGTCGTGAAGGGTATCCTTAAAAAGGATGGCCCCTTGGGCTTCTACCATGGACTCTCGAGTACTCTACTTCAAGAAGTACCGGGTTAT
TTCTTTTTCTTTGGTGGCTATGAACTGAGCCGATCGTTTTTTGCGTCAGGGAGATCAAAAGATGAACTAGGCCCTGTCCATTTGATGTTA
AGTGGTGGAGTTGCTGGAATTTGCCTGTGGCTT A/G TCGTGTTCCCAGTGGATTGTATTAAATCCAGAATTCAAGTTCTTTCCATGTA
TGGGAAACAGGCAGGATTTATTGGTACCCTCTTAAGTGTTGTGAGAAATGAAGGAATAGTAGCCTTATATTCTGGACTGAAAGCTACTAT
GATTCGAGCAATCCCTGCCAATGGGGCACTGTTTGTGGCCTACGAATACAGCAGGAAGATGATGATGAAACAGTTGGAAGCATACTGAAG
TGTCTTGGTGAACCTGGATCCGAGTCCATGAGTTTGAGGACTACAGTTCATCACAGGGTTCAGCAGAG-3'

[Top]

RS ID: 3749779 Link_out

Alleles: G/T

Validation:

  • By frequency
  • By cluster

Details:

Chromosome Reference Position
5 140682891

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_031947 Link_out NP_114153 Link_out 2 V [Val] / G [Gly]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TCTTCATGTGCTACGGGTTCTGCCAGCAGTTTGTCAGGAAAGTGGCTGGAATGGACAAGCAGGCAAAGCTGAGTGATCTCCAGACTG
CAGCCGCGGGGTCCTTCGCCTCTGCATTTGCTGCACTGGCTCTCTGCCCCACTGAGCTTGTGAAGTGCCGGCTACAGACCATGTATGAAA
TGGAGATGTCAGGGAAGATAGCAAAAAGCCATAATACAATTTGGTCTGTCGTGAAGGGTATCCTTAAAAAGGATGGCCCCTTGGGCTTCT
ACCATGGACTCTCGAGTACTCTACTTCAAGAAG G/T ACCGGGTTATTTCTTTTTCTTTGGTGGCTATGAACTGAGCCGATCGTTTTTT
GCGTCAGGGAGATCAAAAGATGAACTAGGCCCTGTCCATTTGATGTTAAGTGGTGGAGTTGCTGGAATTTGCCTGTGGCTTGTCGTGTTC
CCAGTGGATTGTATTAAATCCAGAATTCAAGTTCTTTCCATGTATGGGAAACAGGCAGGATTTATTGGTACCCTCTTAAGTGTTGTGAGA
AATGAAGGAATAGTAGCCTTATATTCTGGACTGAAAGCTACTATGATTCGAGCAATCCCTGCCAATGG-3'