SNPJam Report for SGPL1

Showing coding SNPs for SGPL1 (Gene ID: 8879)

Show all SNPs for this gene at dbSNP

This SNP viewer is in beta and your feedback is appreciated!

This SNPJam view is a snapshot of the information available at dbSNP and HapMap. It has been reformated to include the information most relevant to drug and metabolomics research.

Please note that population frequency data is updated on a nightly basis and may not be present if this gene was recently annotated.

Show all non-coding SNPs

[Top]

RS ID: 115923151 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
10 72636326

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_003901 Link_out NP_003892 Link_out 1 A [Ala] / T [Thr]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-ACCCCAAGCATGAGAGAGCCGAGATTCCCAGGACTAGGAACAACTTGGATGACTACACTTGTCAGAAATATTGTGAAAGGGCAACCA
GGAAATTCCCGTATTTGGGGCTGCATCATTTTAGAACATTTTTTCTTTCTTCAAGGTTCATCTCTCTCTGTCTCTTCTTTCCTAGTATTC
ATTTCTGCATCACATTACTACAC A/G CCCGGAAACGAGTAGCTATACAATTCCTAAAGGACATTCGAGAATCTGTCACTCAAATCATG
AAGAATCCTAAAGCGAAGACCACAGGAATGGTAGGGACACTTGGAGTTTTTTTTCTTCTCTTGGAAATTTAGGTGTTGGTGGAGAGTTTG
AAGGAATCATATGACCCGGAGTCTGTTCCTGCCTCTGCCCCTTTGCCA-3'

[Top]

RS ID: 114726986 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
10 72619145

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_003901 Link_out NP_003892 Link_out 3 A [Ala] / A [Ala]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TTATTTATTTACATGTCTGTCTCCTCTGCTATGTTTTGATCTTTTGGTTGAGGAATATATCTTATCTTTTTTTCCAGTTTATATTGT
TGTGCCTAATACTTAGAAACTGTTGTTTAGTGCATGATTCTTTGTCCTGTATAGTGTAATAGTTTTGATTTCACATCTGCTTGCATTTTT
TTGCAGGCTTATGGAGATTTTGC A/G TGGAGTAACCCCCTGCATCCAGATATCTTCCCAGGACTACGCAAGATAGAGGCAGAAATCGT
GAGGATAGCTTGTTCCCTGTTCAATGGGGGACCAGATTCGTGTGGATGTGTAAGTATATGCAAGGGGCATCCAATAGCCTTATTTTTTAG
GTTAAAATAGAAGAGTTTTTAATAAATATTAATTATATTTTAAAAAAT-3'

[Top]

RS ID: 114461640 Link_out

Alleles: A/G

Validation:

  • By cluster

Details:

Chromosome Reference Position
10 72635165

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_003901 Link_out NP_003892 Link_out 3 E [Glu] / E [Glu]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TATGATTCTGATCTCAGTAAGAACCACTGATCCAGTGTAGCCCTCTTCTTTTTTGAAGATGAGAAGACTAAAGCCCAAAGGGTTAGA
TTGCATTCATTATAAGGAAGACTTTGAATGATTAAAGAGATAGTGACCAGGGGATTGTATGTGACTGAATTTACTTTTTCTTCCTTCATT
TATTTTTTTGTTTTAAGACTGGA A/G AATATCAAAGGCATCTTTGTTTTTGGGAATCCCCAATTGTCAGTCATTGCTCTGGGATCCCG
TGATTTTGACATCTACCGACTATCAAACCTGATGACTGCTAAGGGGTGGAACTTGAACCAGTTGCAGTTCCCACCCAGGTAAGCTTGAAG
AAGCCTCTTTCCCTTATTTTGCTCCATGATTTTGGAAGAACTTGGGTG-3'

[Top]

RS ID: 114165177 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
10 72629631

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_003901 Link_out NP_003892 Link_out 1 K [Lys] / E [Glu]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-ATTTTTAATTTGGGGAAAAATAATCAGAACTTACTCCCGGTAATTTAGATTAGCTGCTAATGGTGTTTTCTATTATTTTGGCCTGAG
TTACATTATTCTCCTCTTCCCTGTCATTTAGTGTGGCTCCCCAAAGTGCCCATGCTGCATTTAACAAAGCAGCCAGTTACTTTGGGATGA
AGATTGTGCGGGTCCCATTGACG A/G AGATGATGGAGGTGGATGTGCGGGTGAGTCCCTCTGGAGGGCCCACTGTCTGTGCTGGGCCC
TGACAGCAGAAGGGCCCTCCTGTTGACTAGCCGTTTCCAGTCAGATGGGTCTGACTGCCTTTGATTGTGGCAGCCAGAATATGAAAAACT
GCATTGATAGTGGTGATTGACTGCAGCTTCAGTCTTTTCATAGGTTCA-3'

[Top]

RS ID: 77130902 Link_out

Alleles: C/T

Validation:

  • By frequency
  • By cluster

Details:

Chromosome Reference Position
10 72637078

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_003901 Link_out NP_003892 Link_out 1 P [Pro] / S [Ser]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GGCTCATTGCTGCAGTTTTATTCTTGCTTTTGGACCTGGCCTCACTAATAATGTCTCTTTCTTTGGATTTGTAGGGTGCCATCTATG
GCATGGCCCAGACAACTGTTGACAGGAATATGGTTGCAGAATTGTCCTCAGTCTTCTTGGACAGCTTGTACAGCACCGACACTGTCACCC
AGGGCAGCCAGATGAATGGTTCT C/T CAAAACCCCACTGAACTTGGACCCTTTCTAGTCTCAAGGGGATTCCAGCCTTCAGAAGGTTC
TTGGGATATGGAACAGGCCGTGCACAACTTTGACATCTGGTCTTGCTCCATAGAGCACAACTCAAGATAGACCATGAGACAGCTTGAGCC
TCAGGATTCTTGTTCTTCCTCTTATCTTCCTTTTGTGGTTTTTAATTT-3'

[Top]

RS ID: 76764645 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
10 72635159

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_003901 Link_out NP_003892 Link_out 3 E [Glu] / E [Glu]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TCCATCTATGATTCTGATCTCAGTAAGAACCACTGATCCAGTGTAGCCCTCTTCTTTTTTGAAGATGAGAAGACTAAAGCCCAAAGG
GTTAGATTGCATTCATTATAAGGAAGACTTTGAATGATTAAAGAGATAGTGACCAGGGGATTGTATGTGACTGAATTTACTTTTTCTTCC
TTCATTTATTTTTTTGTTTTAAG A/G CTGGAAAATATCAAAGGCATCTTTGTTTTTGGGAATCCCCAATTGTCAGTCATTGCTCTGGG
ATCCCGTGATTTTGACATCTACCGACTATCAAACCTGATGACTGCTAAGGGGTGGAACTTGAACCAGTTGCAGTTCCCACCCAGGTAAGC
TTGAAGAAGCCTCTTTCCCTTATTTTGCTCCATGATTTTGGAAGAACT-3'

[Top]

RS ID: 56046015 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
10 72619194

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_003901 Link_out NP_003892 Link_out 1 E [Glu] / K [Lys]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GAGGAATATATCTTATCTTTTTTTCCAGTTTATATTGTTGTGCCTAATACTTAGAAACTGTTGTTTAGTGCATGATTCTTTGTCCTG
TATAGTGTAATAGTTTTGATTTCACATCTGCTTGCATTTTTTTGCAGGCTTATGGAGATTTTGCATGGAGTAACCCCCTGCATCCAGATA
TCTTCCCAGGACTACGCAAGATA A/G AGGCAGAAATCGTGAGGATAGCTTGTTCCCTGTTCAATGGGGGACCAGATTCGTGTGGATGT
GTAAGTATATGCAAGGGGCATCCAATAGCCTTATTTTTTAGGTTAAAATAGAAGAGTTTTTAATAAATATTAATTATATTTTAAAAAATA
AAAAATATTAAAAATATTTTACTACACAAGAAATATTTGATCATTGTAGAAAGGTCATTTTACTACACAAGGAATATTTGATCATTGTAG
AAAGATCCTAATT-3'

[Top]

RS ID: 35130985 Link_out

Alleles: -/T

Validation:

Not Completed

Details:

Chromosome Reference Position
10 72617401

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
frameshift NM_003901 Link_out NP_003892 Link_out 2 G [Gly] / V [Val]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GGACAACATTATTATCAGATTGCCTTTATTGTAGCTAAATGCTATTAATATCTTTTTCACATTGCTGATAATAATGATTTTTCATCT
TTATTTTATTGTGCTAACTCTATTGAACTTTTTTCTTGATTTGCTATAAGAATGCTGTTGGGTTTCCACTCAACATTTTTTTCTTTTGTA
TCCAGAGGAGTTTCTTCCTGTTTCTTCTTTATCAGAACCTGTCTTCCCAGAGATTCTTGCTTACTGACCAGTGACCTTACCTTTCTCTGC
AGACGCCTTCTGGCAAGAGGGGAGAGCCTCTGG -/T AACAGTGTACAGTGGGGAGGAGAAGCTCACTGAGCTCCTTGTGAAGGTGAGT
GTCCAGTTCTTGAGGGAAGCCTGTGAGGTCTGTGCCAGTTTACATGACCTCCTTTTTTTCCCTTACTTTTGTAATTAGAAAAATTACTTA
AGGAAAGCTTATTGGTACAATAAAACCATAAAAGTTTCTCTTCACCCAAACATAGGCGAATATGTATAATATTATCAAAGACATCTTCAG
TCTGTAAAATAGTAAAATGTTATTTATGTTTTCAGTCTTTGCAGATGTCCTGTCTAGAAGGCAGATTA-3'

[Top]

RS ID: 12770335 Link_out

Alleles: G/T

Validation:

  • By frequency
  • By cluster

Details:

Chromosome Reference Position
10 72604263

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_003901 Link_out NP_003892 Link_out 1 V [Val] / L [Leu]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-ATCTAGCTTAACCCTCTTACTGTATAAAATAGGCACAAGATTGAAAATAGTCTCAAAGTCCACTAGCTGTTAAGTGGCAGTGGAGTG
CTGCTGGAGTGACTGGTACAGAAGCCTTGAGGGCTGTAGATGATAATAAGATTATTGCTGAAGAAGGGCAAGATCCGGAATGACCTTGCC
CTTGAAAAATGAGAGTTGAAGTACAAACTAAGAACAGACTTCTTTTCTCTCTCTAAATGTAATGTTTTTATTTTTCACTTGTATTTCTAG
AAGGCCTTTGAGCCCTACTTAGAGATTTTGGAA G/T TATACTCCACAAAAGCCAAGAATTATGTAAATGGACATTGCACCAAGTATGA
GCCCTGGCAGCTAATTGCATGGAGTGTCGTGTGGACCCTGCTGATAGTCTGGGGATATGAGTTTGTCTTCCAGCCAGAGAGTAAGTATGC
TGTCTCCTCTGTAAAGGTATAGTGGTGTGTCACTAGCCTCAAACTAATTGCTGAGAGATAGGACTAATTTATTGCCTTTTGGTTGTTTTT
TTGTTTGTTTGTTTGTTTTTGAGACGGAGTCTCCATCTGTTGCTAGGCTGGAGTGCACTGGCCTGATC-3'

[Top]

RS ID: 11597050 Link_out

Alleles: A/G

Validation:

  • By cluster
  • By frequency
  • By 2 hit 2 allele
  • By hap map

Details:

Chromosome Reference Position
10 72614524

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_003901 Link_out NP_003892 Link_out 3 K [Lys] / K [Lys]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GTTTCACCATGTTGGCCAGGCTGGTCTCGAACTCCTGACCTGTAATGATCTGCCCACCTCGGCTTCCTGAAGAGCTGTGATAATAGG
TGTAAGCCACCGCGACCGGCTGAGTGCATCTTGACCTTTAGAGAGAAGCTTCGCTTTTCAAATTTTTAAGAGGCTATTGTACATGCCAGA
AAGTAGCTGATCAGTCAGAATATCACCATATATCTTTAGGAAAAATGTTAGTTTAGTTACTTGTGCGGTGCCTAGCATTGAGCAGTTGCT
TGACTGTCATAATAATTCTGCTGTCTCTACTGTACTCTTGCATCTGGATAACTTTGTCTTTCTTACCTTTGGAGATTCAAGACAAGTTGA
ACAAGACCAAGGATGATATTAGCAAGAACATGTCATTCCTGAA A/G GTGGACAAAGAGTATGTGAAAGCTTTACCCTCCCAGGGTCTG
AGCTCATCTGCTGTTTTGGAGAAACTTAAGGAGTACAGCTCTATGGGTATGATGCTTGGCATATACATGCTCTCTACTTCCTTAAAGAGA
CAGGTTTTGTCATTGTTTAATGTTCACATAGGTTAAGAATAACTCATCATTGGTTAATACATGTTTAGGAGGGCCTACTCTCTGTTTCAC
AGGTTGAATTTCCTATTTTTAAAATTATGTTTAGATTCATCCTTCATCCATAAAGCAAGCAAATCTCAGAGACAGTGGAACTTGGCTTTT
ATTTCCTTTTGTAAGCATGAATAAAACAAATATATTTGTGTTTAAGAAGAGAGAATATAAGATATGTAATACAAATGAAATACAGATC-3
'

[Top]

RS ID: 865832 Link_out

Alleles: A/G

Validation:

  • By cluster
  • By frequency
  • By submitter
  • By 2 hit 2 allele

Details:

Chromosome Reference Position
10 72631626

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_003901 Link_out NP_003892 Link_out 3 V [Val] / V [Val]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CTCTACCACTATACCCCATCACCTGAACCAGCTGATCTGGTGACGGCAAAGAGAGAGTTTAAAACAAGCATCTGATGAGAATTCTAT
AGTTAATTTTATACTTTGCGGGGAAGCTACCAATTTATTTTATCAATAATAGTCAAAATAATCAACTGGTAACACTTGATCTCCTCCTTA
GCTCACCTTATGGGTGTCAGCTGAAATGCTGGTTACACCTTTCACCCGGAAATCAAATGGGTGCTCCAGTGGGTATCCTGCTTTCTCCAT
AAAGACGATGAGGAAGCCTCCCAGACAAGCGTC A/G ACATGAAGGGGTATTTTGTATTTGACAGCCAGCTTGTTCCAAAAAACAAAGA
ACATAAGAGAATTTCCTTTATAGCCCTATAATAAAAACTGCAAGACATGGGTGGAAAGATGGGCTATAAACACAAGGCTATTTTGTATTA
TGCCTCCCATGTTTTTAAAAAATGGCTATTTTTAACATTCCCAACAAAATTTATCTTTCAAATGTATTTTCCCTTCAAAATAATTCATCT
GAAATATGGTATCAATTTTATATTTAAATATGCATGACCTCAAACGCTCTGCGGTATCAAGCAGGAAA-3'

[Top]

RS ID: 827255 Link_out

Alleles: A/G

Validation:

  • By frequency
  • By hap map
  • By cluster

Details:

Chromosome Reference Position
10 72619205

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_003901 Link_out NP_003892 Link_out 3 I [Ile] / I [Ile]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-ATAGGGGAATGGTAGGTATGCAGGTGGGGGATGAGGGAAGAAGCGGGTAGGGAGGGAAAGAGTGTAGAGAGCAGATATGGCAACATA
TTTACATTTAGTGAATCTAAGGTGTTCTTTAAGCCATCCTAGCAACTCAATGTAGGTTCAAAGTTTTTCAAAATAAAAAGGTGAAAATAA
AAATATCTAGAAGAATATATACCAAAATGTTGACATTGTCTAGGTTACAAAATTACAAGTAACATTTAAAACTGCAGTTAATTAGGATCT
TTCTACAATGATCAAATATTCCTTGTGTAGTAAAATGACCTTTCTACAATGATCAAATATTTCTTGTGTAGtaaaatatttttaatattt
tttattttttaaaatataattaatatttattaaaaaCTCTTCTATTTTAACCTAAAAAATAAGGCTATTGGATGCCCCTTGCATATACTT
ACACATCCACACGAATCTGGTCCCCCATTGAACAGGGAACAAGCTATCCTCAC A/G ATTTCTGCCTCTATCTTGCGTAGTCCTGGGAA
GATATCTGGATGCAGGGGGTTACTCCATGCAAAATCTCCATAAGCCTGCAAAAAAATGCAAGCAGATGTGAAATCAAAACTATTACACTA
TACAGGACAAAGAATCATGCACTAAACAACAGTTTCTAAGTATTAGGCACAACAATATAAACTGGAAAAAAAGATAAGATATATTCCTCA
ACCAAAAGATCAAAACATAGCAGAGGAGACAGACATGTAAATAAATAATTTTACAATGTGATGAGGAAAGAagtataaatatggttaaaa
gcgcagactataacaccaaaccgacccaggaggaagtctaagctttgcctattactttcagctgtgtAGGTCACATAATCTAAGGTTGTT
TCTTCATACGCAGAAGTTGT-3'

[Top]

RS ID: 827249 Link_out

Alleles: A/G

Validation:

  • By frequency
  • By cluster

Details:

Chromosome Reference Position
10 72629567

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_003901 Link_out NP_003892 Link_out 3 A [Ala] / A [Ala]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AAGTTAGTGACTAGATCACCTCCCTTTCAGAATTCATGAACCTATGAAAAGACTGAAGCTGCAGTCAATCACCACTATCAATGCAGT
TTTTCATATTCTGGCTGCCACAATCAAAGGCAGTCAGACCCATCTGACTGGAAACGGCTAGTCAACAGGAGGGCCCTTCTGCTGTCAGGG
CCCAGCACAGACAGTGGGCCCTCCAGAGGGACTCACCCGCACATCCACCTCCATCATCTTCGTCAATGGGACCCGCACAATCTTCATCCC
AAAGTAACTGGCTGCTTTGTTAAATGCAGCATG A/G GCACTTTGGGGAGCCACACTAAATGACAGGGAAGAGGAGAATAATGTAACTC
AGGCCAAAATAATAGAAAACACCATTAGCAGCTAATCTAAATTACCGGGAGTAAGTTCTGATTATTTTTCCCCAAATTAAAAATTTAAGT
GTTTAGACTGCTCTACTTTTCTTTTTAAGCACACCCAAAAAGAGGCCAACTGATTTTCTGCAGAAACTTCCCTCCTATTTAGGAAATCAT
TCTGGCAATAGGAAGAGGACTCAGAAGTGATCCCACAGTGAGGGATCCAAAGCATAAAGCTAGGCTGG-3'