SNPJam Report for SCN1A

Showing coding SNPs for SCN1A (Gene ID: 6323)

Show all SNPs for this gene at dbSNP

This SNP viewer is in beta and your feedback is appreciated!

This SNPJam view is a snapshot of the information available at dbSNP and HapMap. It has been reformated to include the information most relevant to drug and metabolomics research.

Please note that population frequency data is updated on a nightly basis and may not be present if this gene was recently annotated.

Show all non-coding SNPs

[Top]

RS ID: 7580482 Link_out

Alleles: C/T

Validation:

  • By frequency
  • By 2 hit 2 allele
  • By cluster

Details:

Chromosome Reference Position
2 166903445

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_001165963 Link_out NP_001159435 Link_out 3 V [Val] / V [Val]
coding-synonymous NM_001165964 Link_out NP_001159436 Link_out 3 V [Val] / V [Val]
coding-synonymous NM_006920 Link_out NP_008851 Link_out 3 V [Val] / V [Val]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TACTTTGAGAATCTTAAGATGATTAAAATAGCATGAGAGAGTTCTATTGTGGTTATTATTATACACATCTCAAATAAAATAATTAAA
CTAAATAAAAGTAAGTGGATCATCAAAATATAGAAATCATTATTAATTCCTCATACAACCACCTGCTCTTAGGTACTCACTTTCTCTTCA
ATATTACGTAACAATCAGAACGATAAAAGGTCAGTGCCATGAGACAGGGCAGCTTTACCTGAGCTGCCTCCTGTTGCTTTTTAAGCTGTT
CAATCATCTGCTGAAATTCGGCCTCTTTCTGTTCTGCTTCTTCCAAGGTGGCCTGATTCTGTTCCTCGTAGGCCATGGCCACCACAGCCA
GGATCAAATTTATTAGGTAGAATGAGCCCAAGAAAATGACCAA C/T ACAAAAAATATCATGTACGTTTTCCCAGCAGCACGTAATGTC
TGCAAACAAAAATATCAGAATTATTTCTCAATATTATTTCACTAAGTGGTGGCTTCAACTTTCAATTTACTCATGTGTCTAGCAAAACTC
AGATATAAATAGTAATTATGTTGGTCATAGCACCCTGTACTTTTTTTTTATTGTTTCTTTAACTTCAGCTTCTTCCTTCTCTTCTAGCTT
ATGCATTCACACTATGATTTCTATGGCAGAATTTTTGTATTCACCAAGAATGAAACAGTCAATAAAATGCCATGGAGTCCTCCATTAACG
ACCTGAGCCTTTAGGAAAGTCAAGGAACAGACCAAAGTTATCTTTCTATATCTGCTTTTTCATTTTCATTACTTCCCACCTGAGGGAT-3
'

[Top]

RS ID: 6432860 Link_out

Alleles: A/G

Validation:

  • By cluster
  • By frequency
  • By 2 hit 2 allele
  • By hap map

Details:

Chromosome Reference Position
2 166897864

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_001165963 Link_out NP_001159435 Link_out 3 V [Val] / V [Val]
coding-synonymous NM_001165964 Link_out NP_001159436 Link_out 3 V [Val] / V [Val]
coding-synonymous NM_006920 Link_out NP_008851 Link_out 3 V [Val] / V [Val]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TAAGGGTGATTATTTTTGGCAAAAAAGTAGAGTATAGCCAGCTAAATATAATTGCGATTTTGCAGGGGCCAGGAAGCATGAAGGATG
GTTGAAAGACTGCTATACACAATTAAATGTAAACAGTTTTTCAAGCAGAAAATTTGAAGACTAAACACATTTACCTTCCAATATGCTTAC
CAAGTTTCCTACTGTAAGCACATTATTGAAATGGTCCGTCATTGGATAGTGCTCCATGGCCATGAAAAGAGTATTTAAGACAATACAGAT
GGTGATGGCCAGGTCAACAAATGGGTCCATCAC A/G ACCAGGTTGACAACATGTTTCACTTTTAACCAATATGGAGAACAGTCCCAGA
TTAAGAATATGTTGGAAAATTTATACCAACAGGGTGGGCATTTCTGCCTGGATTCTTCAAGTTCTAGATTAAGAAAAAAAAAAAAAAGAA
CCACCAAAAGGTATACTTTATACACACACATTTATTTCATATCCACTAAACTTATTTTCAGTAATCAACACATTTTTGTTACAGAGACAA
CCTTTTTTGTACTTGTTAAAAAAATTACAGTTTACTCTAAACCTCCCAAGGATATTTCATCAGACACA-3'

[Top]

RS ID: 3749029 Link_out

Alleles: A/G

Validation:

  • By cluster

Details:

Chromosome Reference Position
2 166848014

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_001165963 Link_out NP_001159435 Link_out 2 R [Arg] / H [His]
missense NM_001165964 Link_out NP_001159436 Link_out 2 R [Arg] / H [His]
missense NM_006920 Link_out NP_008851 Link_out 2 R [Arg] / H [His]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AGCCAATCACTACTACTTTAAAACGAAAACAAGAGGAAGTATCTGCTGTCATTATTCAGC A/G TGCTTACAGACGCCACCTTTTA
AAGCGAACTGTAAAACAAGCTTCCTTTACGTACAATAA-3'

[Top]

RS ID: 2298771 Link_out

Alleles: A/G

Validation:

  • By cluster
  • By frequency
  • By submitter
  • By 2 hit 2 allele
  • By hap map

Details:

Chromosome Reference Position
2 166892788

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_001165963 Link_out NP_001159435 Link_out 1 A [Ala] / T [Thr]
missense NM_001165964 Link_out NP_001159436 Link_out 1 A [Ala] / T [Thr]
missense NM_006920 Link_out NP_008851 Link_out 1 A [Ala] / T [Thr]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TCTTCTAATCACTATGCTGTGGTGTTTCCTTCTCATCAAGTTTTAGAACTTAGAGTTTTTTCCACACTTAAAAGAAAGAATAAGTGA
TTGTAATCTGCTCTTCCCTACATTGGTGTAAAATTATAATCATGTTTTTGTTGTTTTTAAGGTCCTGAATCTCTTTCTGGCCTTGCTTCT
GAGCTCATTTAGTGCAGACAACCTTGCAGCCACTGATGATGATAATGAAATGAATAATCTCCAAATTGCTGTGGATAGGATGCACAAAGG
AGTAGCTTATGTGAAAAGAAAAATATATGAATTTATTCAACAGTCCTTCATTAGGAAACAAAAGATTTTAGATGAAATTAAACCACTTGA
TGATCTAAACAACAAGAAAGACAGTTGTATGTCCAATCATACA A/G CAGAAATTGGGAAAGATCTTGACTATCTTAAAGATGTAAATG
GAACTACAAGTGGTATAGGAACTGGCAGCAGTGTTGAAAAATACATTATTGATGAAAGTGATTACATGTCATTCATAAACAACCCCAGTC
TTACTGTGACTGTACCAATTGCTGTAGGAGAATCTGACTTTGAAAATTTAAACACGGAAGACTTTAGTAGTGAATCGGATCTGGAAGAAA
GCAAAGAGGTAAGATTCTATAGGTGTGGGAAGGTATGAATACATATACATATATACATATACACACATACAGATGATCCTCAGCTTAATG
ATGTTTTGACTTAAGATTTTTTTTTTTTTTTACTTTATGATAATACAAAAGCAATAGCCATTCACTAGAAACCATGCTCTAAATTTTG-3
'

[Top]

RS ID: 563792 Link_out

Alleles: C/T

Validation:

  • By cluster

Details:

Chromosome Reference Position
2 166894576

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_001165963 Link_out NP_001159435 Link_out 1 S [Ser] / P [Pro]
missense NM_001165964 Link_out NP_001159436 Link_out 1 S [Ser] / P [Pro]
missense NM_006920 Link_out NP_008851 Link_out 1 S [Ser] / P [Pro]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TTGGCAAAATCTTGGCCAACGTTAAATATGCTAATAAAGATCATCGGCAAT C/T CCGTGGGGGCTCTGGGAAATTAACCCTCGTC
TTGGCCATCATCGTCTTCATTTTTGCCGTGGTCGGCATGCAGCTCTTTGGTAAAAGCTACAAAGATTGTGTCTGCAAGATCGCCAGTGAT
TGTCAACTCCCACGCTGGCACATGAATGACTTCTTCCACTCCTTCCTGATTGTGTTCCGCGTGCTGTGTGGGGAGTGGATAGAGACCATG
TGGGACTGTATGGAGGTTGCTGGTCAAGCCATGTGCCTTACTGTCTTCATGATGGTCATGGTGATTGGAAACCTAGTGGTATGTACCCAC
TTAAGATATGCATTTTGGAAATAcaccagcatggcacatgtatacatatgtaactaacctgcacattgtgcacatgtaccctaaaactta
aagtataataaAAAAAAAGAGTATAATTTAATGGTGACTGTTTTGTCAAAAAGAAAAACAAACTATGATTATTGGTTTAAAAGTCCATTA
CCTTGGATATATTATCACTTTAACAACACAGCAATATAGCAGTGCCCCTGCAT-3'