SNPJam Report for SCN1A

Showing coding SNPs for SCN1A (Gene ID: 6323)

Show all SNPs for this gene at dbSNP

This SNP viewer is in beta and your feedback is appreciated!

This SNPJam view is a snapshot of the information available at dbSNP and HapMap. It has been reformated to include the information most relevant to drug and metabolomics research.

Please note that population frequency data is updated on a nightly basis and may not be present if this gene was recently annotated.

Show all non-coding SNPs

[Top]

RS ID: 7580482 Link_out

Alleles: C/T

Validation:

  • By frequency
  • By 2 hit 2 allele
  • By cluster

Details:

Chromosome Reference Position
2 166903445

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_001165963 Link_out NP_001159435 Link_out 3 V [Val] / V [Val]
coding-synonymous NM_001165964 Link_out NP_001159436 Link_out 3 V [Val] / V [Val]
coding-synonymous NM_006920 Link_out NP_008851 Link_out 3 V [Val] / V [Val]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TACTTTGAGAATCTTAAGATGATTAAAATAGCATGAGAGAGTTCTATTGTGGTTATTATTATACACATCTCAAATAAAATAATTAAA
CTAAATAAAAGTAAGTGGATCATCAAAATATAGAAATCATTATTAATTCCTCATACAACCACCTGCTCTTAGGTACTCACTTTCTCTTCA
ATATTACGTAACAATCAGAACGATAAAAGGTCAGTGCCATGAGACAGGGCAGCTTTACCTGAGCTGCCTCCTGTTGCTTTTTAAGCTGTT
CAATCATCTGCTGAAATTCGGCCTCTTTCTGTTCTGCTTCTTCCAAGGTGGCCTGATTCTGTTCCTCGTAGGCCATGGCCACCACAGCCA
GGATCAAATTTATTAGGTAGAATGAGCCCAAGAAAATGACCAA C/T ACAAAAAATATCATGTACGTTTTCCCAGCAGCACGTAATGTC
TGCAAACAAAAATATCAGAATTATTTCTCAATATTATTTCACTAAGTGGTGGCTTCAACTTTCAATTTACTCATGTGTCTAGCAAAACTC
AGATATAAATAGTAATTATGTTGGTCATAGCACCCTGTACTTTTTTTTTATTGTTTCTTTAACTTCAGCTTCTTCCTTCTCTTCTAGCTT
ATGCATTCACACTATGATTTCTATGGCAGAATTTTTGTATTCACCAAGAATGAAACAGTCAATAAAATGCCATGGAGTCCTCCATTAACG
ACCTGAGCCTTTAGGAAAGTCAAGGAACAGACCAAAGTTATCTTTCTATATCTGCTTTTTCATTTTCATTACTTCCCACCTGAGGGAT-3
'

[Top]

RS ID: 6432860 Link_out

Alleles: A/G

Validation:

  • By cluster
  • By frequency
  • By 2 hit 2 allele
  • By hap map

Details:

Chromosome Reference Position
2 166897864

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_001165963 Link_out NP_001159435 Link_out 3 V [Val] / V [Val]
coding-synonymous NM_001165964 Link_out NP_001159436 Link_out 3 V [Val] / V [Val]
coding-synonymous NM_006920 Link_out NP_008851 Link_out 3 V [Val] / V [Val]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TAAGGGTGATTATTTTTGGCAAAAAAGTAGAGTATAGCCAGCTAAATATAATTGCGATTTTGCAGGGGCCAGGAAGCATGAAGGATG
GTTGAAAGACTGCTATACACAATTAAATGTAAACAGTTTTTCAAGCAGAAAATTTGAAGACTAAACACATTTACCTTCCAATATGCTTAC
CAAGTTTCCTACTGTAAGCACATTATTGAAATGGTCCGTCATTGGATAGTGCTCCATGGCCATGAAAAGAGTATTTAAGACAATACAGAT
GGTGATGGCCAGGTCAACAAATGGGTCCATCAC A/G ACCAGGTTGACAACATGTTTCACTTTTAACCAATATGGAGAACAGTCCCAGA
TTAAGAATATGTTGGAAAATTTATACCAACAGGGTGGGCATTTCTGCCTGGATTCTTCAAGTTCTAGATTAAGAAAAAAAAAAAAAAGAA
CCACCAAAAGGTATACTTTATACACACACATTTATTTCATATCCACTAAACTTATTTTCAGTAATCAACACATTTTTGTTACAGAGACAA
CCTTTTTTGTACTTGTTAAAAAAATTACAGTTTACTCTAAACCTCCCAAGGATATTTCATCAGACACA-3'

[Top]

RS ID: 3749029 Link_out

Alleles: A/G

Validation:

  • By cluster

Details:

Chromosome Reference Position
2 166848014

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_001165963 Link_out NP_001159435 Link_out 2 R [Arg] / H [His]
missense NM_001165964 Link_out NP_001159436 Link_out 2 R [Arg] / H [His]
missense NM_006920 Link_out NP_008851 Link_out 2 R [Arg] / H [His]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AGCCAATCACTACTACTTTAAAACGAAAACAAGAGGAAGTATCTGCTGTCATTATTCAGC A/G TGCTTACAGACGCCACCTTTTA
AAGCGAACTGTAAAACAAGCTTCCTTTACGTACAATAA-3'

[Top]

RS ID: 2298771 Link_out

Alleles: A/G

Validation:

  • By cluster
  • By frequency
  • By submitter
  • By 2 hit 2 allele
  • By hap map

Details:

Chromosome Reference Position
2 166892788

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_001165963 Link_out NP_001159435 Link_out 1 A [Ala] / T [Thr]
missense NM_001165964 Link_out NP_001159436 Link_out 1 A [Ala] / T [Thr]
missense NM_006920 Link_out NP_008851 Link_out 1 A [Ala] / T [Thr]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TCTTCTAATCACTATGCTGTGGTGTTTCCTTCTCATCAAGTTTTAGAACTTAGAGTTTTTTCCACACTTAAAAGAAAGAATAAGTGA
TTGTAATCTGCTCTTCCCTACATTGGTGTAAAATTATAATCATGTTTTTGTTGTTTTTAAGGTCCTGAATCTCTTTCTGGCCTTGCTTCT
GAGCTCATTTAGTGCAGACAACCTTGCAGCCACTGATGATGATAATGAAATGAATAATCTCCAAATTGCTGTGGATAGGATGCACAAAGG
AGTAGCTTATGTGAAAAGAAAAATATATGAATTTATTCAACAGTCCTTCATTAGGAAACAAAAGATTTTAGATGAAATTAAACCACTTGA
TGATCTAAACAACAAGAAAGACAGTTGTATGTCCAATCATACA A/G CAGAAATTGGGAAAGATCTTGACTATCTTAAAGATGTAAATG
GAACTACAAGTGGTATAGGAACTGGCAGCAGTGTTGAAAAATACATTATTGATGAAAGTGATTACATGTCATTCATAAACAACCCCAGTC
TTACTGTGACTGTACCAATTGCTGTAGGAGAATCTGACTTTGAAAATTTAAACACGGAAGACTTTAGTAGTGAATCGGATCTGGAAGAAA
GCAAAGAGGTAAGATTCTATAGGTGTGGGAAGGTATGAATACATATACATATATACATATACACACATACAGATGATCCTCAGCTTAATG
ATGTTTTGACTTAAGATTTTTTTTTTTTTTTACTTTATGATAATACAAAAGCAATAGCCATTCACTAGAAACCATGCTCTAAATTTTG-3
'

[Top]

RS ID: 563792 Link_out

Alleles: C/T

Validation:

  • By cluster

Details:

Chromosome Reference Position
2 166894576

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_001165963 Link_out NP_001159435 Link_out 1 S [Ser] / P [Pro]
missense NM_001165964 Link_out NP_001159436 Link_out 1 S [Ser] / P [Pro]
missense NM_006920 Link_out NP_008851 Link_out 1 S [Ser] / P [Pro]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TTGGCAAAATCTTGGCCAACGTTAAATATGCTAATAAAGATCATCGGCAAT C/T CCGTGGGGGCTCTGGGAAATTAACCCTCGTC
TTGGCCATCATCGTCTTCATTTTTGCCGTGGTCGGCATGCAGCTCTTTGGTAAAAGCTACAAAGATTGTGTCTGCAAGATCGCCAGTGAT
TGTCAACTCCCACGCTGGCACATGAATGACTTCTTCCACTCCTTCCTGATTGTGTTCCGCGTGCTGTGTGGGGAGTGGATAGAGACCATG
TGGGACTGTATGGAGGTTGCTGGTCAAGCCATGTGCCTTACTGTCTTCATGATGGTCATGGTGATTGGAAACCTAGTGGTATGTACCCAC
TTAAGATATGCATTTTGGAAATAcaccagcatggcacatgtatacatatgtaactaacctgcacattgtgcacatgtaccctaaaactta
aagtataataaAAAAAAAGAGTATAATTTAATGGTGACTGTTTTGTCAAAAAGAAAAACAAACTATGATTATTGGTTTAAAAGTCCATTA
CCTTGGATATATTATCACTTTAACAACACAGCAATATAGCAGTGCCCCTGCAT-3'

[Top]

RS ID: 398123601 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
2 166073539

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_001165963 Link_out NP_001159435 Link_out 2 R [Arg] / H [His]
missense NM_001165964 Link_out NP_001159436 Link_out 2 R [Arg] / H [His]
missense NM_006920 Link_out NP_008851 Link_out 2 R [Arg] / H [His]
missense NM_001202435 Link_out NP_001189364 Link_out 2 R [Arg] / H [His]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TGACAGCTTCAACTTCTTCACCAGAGAATCTCTTGCGGCTATTGAAAGAC A/G CATTGCAGAAGAAAAGGCAAAGAATCCCAAAC
CAGACAAAAAAGATGACG-3'

[Top]

RS ID: 398123599 Link_out

Alleles: -/C

Validation:

Not Completed

Details:

Chromosome Reference Position
2 165991736

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
frameshift-variant NM_001165963 Link_out NP_001159435 Link_out 1 L [Leu] / S [Ser]
frameshift-variant NM_001165964 Link_out NP_001159436 Link_out 1 L [Leu] / S [Ser]
frameshift-variant NM_006920 Link_out NP_008851 Link_out 1 L [Leu] / S [Ser]
frameshift-variant NM_001202435 Link_out NP_001189364 Link_out 1 L [Leu] / S [Ser]
intron-variant XR_427187 Link_out Not Applicable Not Applicable Not Applicable
intron-variant NR_110598 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AGTTTGCAGCTGCGCTTGAACCGCCTCTCAATCTGCCACAACCAAACAAA -/C TCCAGCTCATTGCCATGGATTTGCCCATGGTG
AGTGGTGACCGGATCCAC-3'

[Top]

RS ID: 398123598 Link_out

Alleles: A/T

Validation:

Not Completed

Details:

Chromosome Reference Position
2 165994331

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
intron-variant XR_427187 Link_out Not Applicable Not Applicable Not Applicable
intron-variant NR_110598 Link_out Not Applicable Not Applicable Not Applicable
missense NM_001165963 Link_out NP_001159435 Link_out 2 V [Val] / D [Asp]
missense NM_001165964 Link_out NP_001159436 Link_out 2 V [Val] / D [Asp]
missense NM_006920 Link_out NP_008851 Link_out 2 V [Val] / D [Asp]
missense NM_001202435 Link_out NP_001189364 Link_out 2 V [Val] / D [Asp]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CAGACAAGTTTTTGACATAAGCATCATGATTCTCATCTGTCTTAACATGG A/T CACAATGATGGTGGAAACAGATGACCAGAGTG
AATATGTGACTACCATTT-3'

[Top]

RS ID: 398123597 Link_out

Alleles: A/C

Validation:

Not Completed

Details:

Chromosome Reference Position
2 165994414

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
intron-variant XR_427187 Link_out Not Applicable Not Applicable Not Applicable
intron-variant NR_110598 Link_out Not Applicable Not Applicable Not Applicable
missense NM_001165963 Link_out NP_001159435 Link_out 3 N [Asn] / K [Lys]
missense NM_001165964 Link_out NP_001159436 Link_out 3 N [Asn] / K [Lys]
missense NM_006920 Link_out NP_008851 Link_out 3 N [Asn] / K [Lys]
missense NM_001202435 Link_out NP_001189364 Link_out 3 N [Asn] / K [Lys]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-ACATGAGAAAACTCCTTTGTTGTTAAAAGCATTTCTATTTCTCTACAGAA A/C AAATTTCAAGGAATGGTCTTTGACTTCGTAAC
CAGACAAGTTTTTGACAT-3'

[Top]

RS ID: 398123594 Link_out

Alleles: C/G

Validation:

Not Completed

Details:

Chromosome Reference Position
2 166002514

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
intron-variant XR_427187 Link_out Not Applicable Not Applicable Not Applicable
intron-variant NR_110598 Link_out Not Applicable Not Applicable Not Applicable
missense NM_001165963 Link_out NP_001159435 Link_out 3 N [Asn] / K [Lys]
missense NM_001165964 Link_out NP_001159436 Link_out 3 N [Asn] / K [Lys]
missense NM_006920 Link_out NP_008851 Link_out 3 N [Asn] / K [Lys]
missense NM_001202435 Link_out NP_001189364 Link_out 3 N [Asn] / K [Lys]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AAACTAATAGAAAGAAATGAGACTGCTCGATGGAAAAATGTGAAAGTAAA C/G TTTGATAATGTAGGATTTGGGTATCTCTCTTT
GCTTCAAGTTGTAAGTGA-3'

[Top]

RS ID: 398123593 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
2 166002537

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
intron-variant XR_427187 Link_out Not Applicable Not Applicable Not Applicable
intron-variant NR_110598 Link_out Not Applicable Not Applicable Not Applicable
stop-gained NM_001165963 Link_out NP_001159435 Link_out 1 R [Arg] / *
stop-gained NM_001165964 Link_out NP_001159436 Link_out 1 R [Arg] / *
stop-gained NM_006920 Link_out NP_008851 Link_out 1 R [Arg] / *
stop-gained NM_001202435 Link_out NP_001189364 Link_out 1 R [Arg] / *

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TGAATAATCATACTGATTGCCTAAAACTAATAGAAAGAAATGAGACTGCT C/T GATGGAAAAATGTGAAAGTAAACTTTGATAAT
GTAGGATTTGGGTATCTC-3'

[Top]

RS ID: 398123592 Link_out

Alleles: C/G

Validation:

Not Completed

Details:

Chromosome Reference Position
2 166012171

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
intron-variant XR_427187 Link_out Not Applicable Not Applicable Not Applicable
intron-variant NR_110598 Link_out Not Applicable Not Applicable Not Applicable
missense NM_001165963 Link_out NP_001159435 Link_out 1 A [Ala] / P [Pro]
missense NM_001165964 Link_out NP_001159436 Link_out 1 A [Ala] / P [Pro]
missense NM_006920 Link_out NP_008851 Link_out 1 A [Ala] / P [Pro]
missense NM_001202435 Link_out NP_001189364 Link_out 1 A [Ala] / P [Pro]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-ACAAGGTTTTCACTTACATTTTCATTCTGGAAATGCTTCTAAAATGGGTG C/G CATATGGCTATCAAACATATTTCACCAATGCC
TGGTGTTGGCTGGACTTC-3'

[Top]

RS ID: 398123591 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
2 166012212

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
intron-variant XR_427187 Link_out Not Applicable Not Applicable Not Applicable
intron-variant NR_110598 Link_out Not Applicable Not Applicable Not Applicable
missense NM_001165963 Link_out NP_001159435 Link_out 2 F [Phe] / S [Ser]
missense NM_001165964 Link_out NP_001159436 Link_out 2 F [Phe] / S [Ser]
missense NM_006920 Link_out NP_008851 Link_out 2 F [Phe] / S [Ser]
missense NM_001202435 Link_out NP_001189364 Link_out 2 F [Phe] / S [Ser]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TGATCAGCGAAAGACGATTAAGACGATGTTGGAATATGCTGACAAGGTTT C/T CACTTACATTTTCATTCTGGAAATGCTTCTAA
AATGGGTGGCATATGGCT-3'

[Top]

RS ID: 398123590 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
2 166013803

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
intron-variant XR_427187 Link_out Not Applicable Not Applicable Not Applicable
intron-variant NR_110598 Link_out Not Applicable Not Applicable Not Applicable
missense NM_001165963 Link_out NP_001159435 Link_out 1 E [Glu] / K [Lys]
missense NM_001165964 Link_out NP_001159436 Link_out 1 E [Glu] / K [Lys]
missense NM_006920 Link_out NP_008851 Link_out 1 E [Glu] / K [Lys]
missense NM_001202435 Link_out NP_001189364 Link_out 1 E [Glu] / K [Lys]
upstream-variant-2KB XR_427186 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GCAGAGGAAAACAATGGTGGAACCTGAGAAGGACGTGTTTCCGAATAGTT A/G AACATAACTGGTTTGAGACCTTCATTGTTTTC
ATGATTCTCCTTAGTAGT-3'

[Top]

RS ID: 398123589 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
2 166037906

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_001165963 Link_out NP_001159435 Link_out 2 H [His] / R [Arg]
missense NM_001165964 Link_out NP_001159436 Link_out 2 H [His] / R [Arg]
missense NM_006920 Link_out NP_008851 Link_out 2 H [His] / R [Arg]
missense NM_001202435 Link_out NP_001189364 Link_out 2 H [His] / R [Arg]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GATCGCCAGTGATTGTCAACTCCCACGCTGGCACATGAATGACTTCTTCC A/G CTCCTTCCTGATTGTGTTCCGCGTGCTGTGTG
GGGAGTGGATAGAGACCA-3'

[Top]

RS ID: 398123588 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
2 166039436

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_001165963 Link_out NP_001159435 Link_out 2 R [Arg] / H [His]
missense NM_001165964 Link_out NP_001159436 Link_out 2 R [Arg] / H [His]
missense NM_006920 Link_out NP_008851 Link_out 2 R [Arg] / H [His]
missense NM_001202435 Link_out NP_001189364 Link_out 2 R [Arg] / H [His]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TAGCCTGGTAGAACTTGGACTCGCCAATGTGGAAGGATTATCTGTTCTCC A/G TTCATTTCGATTGGTAAAAAAAAAAAAAAAAA
GCACCAAATTCAAAAACC-3'

[Top]

RS ID: 398123586 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
2 166043764

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_001165963 Link_out NP_001159435 Link_out 1 V [Val] / M [Met]
missense NM_001165964 Link_out NP_001159436 Link_out 1 V [Val] / M [Met]
missense NM_006920 Link_out NP_008851 Link_out 1 V [Val] / M [Met]
missense NM_001202435 Link_out NP_001189364 Link_out 1 V [Val] / M [Met]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CAGTGTTTCCAGCGAATGGGAAGATGCACAGCACTGTGGATTGCAATGGT A/G TGGTTTCCTTGGTTGGTGGACCTTCAGTTCCT
ACATCGCCTGTTGGACAG-3'

[Top]

RS ID: 398123585 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
2 166043875

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
stop-gained NM_001165963 Link_out NP_001159435 Link_out 1 R [Arg] / *
stop-gained NM_001165964 Link_out NP_001159436 Link_out 1 R [Arg] / *
stop-gained NM_006920 Link_out NP_008851 Link_out 1 R [Arg] / *
stop-gained NM_001202435 Link_out NP_001189364 Link_out 1 R [Arg] / *

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GCACCTTTGAGGATAACGAGAGCCGTAGAGATTCCTTGTTTGTGCCCCGA C/T GACACGGAGAGAGACGCAACAGCAACCTGAGT
CAGACCAGTAGGTCATCC-3'

[Top]

RS ID: 398123584 Link_out

Alleles: A/T

Validation:

Not Completed

Details:

Chromosome Reference Position
2 166043946

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_001165963 Link_out NP_001159435 Link_out 2 D [Asp] / V [Val]
missense NM_001165964 Link_out NP_001159436 Link_out 2 D [Asp] / V [Val]
missense NM_006920 Link_out NP_008851 Link_out 2 D [Asp] / V [Val]
missense NM_001202435 Link_out NP_001189364 Link_out 2 D [Asp] / V [Val]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AAGCCTTTTCAGCTTTAGAGGGCGAGCAAAGGATGTGGGATCTGAGAACG A/T CTTCGCAGATGATGAGCACAGCACCTTTGAGG
ATAACGAGAGCCGTAGAG-3'

[Top]

RS ID: 398123582 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
2 166045221

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_001165963 Link_out NP_001159435 Link_out 2 K [Lys] / R [Arg]
missense NM_001165964 Link_out NP_001159436 Link_out 2 K [Lys] / R [Arg]
missense NM_006920 Link_out NP_008851 Link_out 2 K [Lys] / R [Arg]
missense NM_001202435 Link_out NP_001189364 Link_out 2 K [Lys] / R [Arg]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GCTCTCAGACAGCTCATCTGAAGCCTCTAAGTTGAGTTCCAAGAGTGCTA A/G GGAAAGAAGAAATCGGAGGAAGAAAAGAAAAC
AGAAAGAGCAGTCTGGTG-3'

[Top]

RS ID: 398123581 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
2 166046927

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_001165963 Link_out NP_001159435 Link_out 2 I [Ile] / T [Thr]
missense NM_001165964 Link_out NP_001159436 Link_out 2 I [Ile] / T [Thr]
missense NM_006920 Link_out NP_008851 Link_out 2 I [Ile] / T [Thr]
missense NM_001202435 Link_out NP_001189364 Link_out 2 I [Ile] / T [Thr]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GACATTACGTGCTGCTGGGAAAACGTACATGATATTTTTTGTATTGGTCA C/T TTTCTTGGGCTCATTCTACCTAATAAATTTGA
TCCTGGCTGTGGTGGCCA-3'

[Top]

RS ID: 398123580 Link_out

Alleles: -/T

Validation:

Not Completed

Details:

Chromosome Reference Position
2 166047635

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
frameshift-variant NM_001165963 Link_out NP_001159435 Link_out 1 Y [Tyr] / I [Ile]
frameshift-variant NM_001165964 Link_out NP_001159436 Link_out 1 Y [Tyr] / I [Ile]
frameshift-variant NM_006920 Link_out NP_008851 Link_out 1 Y [Tyr] / I [Ile]
frameshift-variant NM_001202435 Link_out NP_001189364 Link_out 1 Y [Tyr] / I [Ile]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CTTTTTTGTCCTTGTTTCGACTAATGACTCAGGACTTCTGGGAAAATCTT -/T ATCAACTGGTGAGAACTAAAGAGCCACACTCT
CCATTTAAGTAAAAGTAT-3'

[Top]

RS ID: 398123578 Link_out

Alleles: G/T

Validation:

Not Completed

Details:

Chromosome Reference Position
2 166048908

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_001165963 Link_out NP_001159435 Link_out 1 C [Cys] / G [Gly]
missense NM_001165964 Link_out NP_001159436 Link_out 1 C [Cys] / G [Gly]
missense NM_006920 Link_out NP_008851 Link_out 1 C [Cys] / G [Gly]
missense NM_001202435 Link_out NP_001189364 Link_out 1 C [Cys] / G [Gly]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TTCAAACAGGATATCATTATTTCCTGGAGGGTTTTTTAGATGCACTACTA G/T GTGGAAATAGCTCTGATGCAGGGTAAGTCAAT
AATTTGTGTGTATCTGTG-3'

[Top]

RS ID: 397514459 Link_out

Alleles: C/G

Validation:

Not Completed

Details:

Chromosome Reference Position
2 166039428

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_001165963 Link_out NP_001159435 Link_out 1 R [Arg] / G [Gly]
missense NM_001165964 Link_out NP_001159436 Link_out 1 R [Arg] / G [Gly]
missense NM_006920 Link_out NP_008851 Link_out 1 R [Arg] / G [Gly]
missense NM_001202435 Link_out NP_001189364 Link_out 1 R [Arg] / G [Gly]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TAGAACTTGGACTCGCCAATGTGGAAGGATTATCTGTTCTCCGTTCATTT C/G GATTGGTAAAAAAAAAAAAAAAAAGCACCAAA
TTCAAAAACCTTTCTAAC-3'

[Top]

RS ID: 397514458 Link_out

Alleles: A/C

Validation:

Not Completed

Details:

Chromosome Reference Position
2 165992269

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
intron-variant XR_427187 Link_out Not Applicable Not Applicable Not Applicable
intron-variant NR_110598 Link_out Not Applicable Not Applicable Not Applicable
missense NM_001165963 Link_out NP_001159435 Link_out 2 A [Ala] / E [Glu]
missense NM_001165964 Link_out NP_001159436 Link_out 2 A [Ala] / E [Glu]
missense NM_006920 Link_out NP_008851 Link_out 2 A [Ala] / E [Glu]
missense NM_001202435 Link_out NP_001189364 Link_out 2 A [Ala] / E [Glu]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AGCAAAGGGGATCCGCACGCTGCTCTTTGCTTTGATGATGTCCCTTCCTG A/C GTTGTTTAACATCGGCCTCCTACTCTTCCTAG
TCATGTTCATCTACGCCA-3'