SNPJam Report for PIM1

Showing coding SNPs for PIM1 (Gene ID: 5292)

Show all SNPs for this gene at dbSNP

This SNP viewer is in beta and your feedback is appreciated!

This SNPJam view is a snapshot of the information available at dbSNP and HapMap. It has been reformated to include the information most relevant to drug and metabolomics research.

Please note that population frequency data is updated on a nightly basis and may not be present if this gene was recently annotated.

Show all non-coding SNPs

[Top]

RS ID: 66515835 Link_out

Alleles: -/T

Validation:

Not Completed

Details:

Chromosome Reference Position
6 37138567

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
frameshift NM_002648 Link_out NP_002639 Link_out 2 Not Applicable
intron XM_002342627 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AGCGCCCTCAGTTGTCCTCCGACTCGCCCTCGGCCTTCCGCGCCAGCCGCAGCCACAGCCGCAACGCCACCCGCAGCCACAGCCACA
GCCACAGCCCCAGGCATAGCCTTCGGCACAGCCCCGGCTCCGGCTCCTGCGGCAGCTCCTCTGGGCACCGTCCCTGCGCCGACATCCTGG
AGGTTGGGATGCTCTTGTCCAAAATCAACTCGCTTGCCCACCTGCGCGCCGCGCCCTGCAACGACCTGCACGCCACCAAGCTGGCGCCCG
GTGAGAGCACCCCCCGCCTCCGGCCCGGGGATGCGGGGCGGCGGCGGGATCTCCTGGGTGGGGAGCTGGCGGCTCGCGGGCCGGCACTGA
GTCCCCGTGCTTCCCCCTTTCCTAGGCAAGGAGAAGGAGCCCC -/T GGAGTCGCAGTACCAGGTGGGCCCGCTACTGGGCAGCGGCGG
CTTCGGCTCGGTCTACTCAGGCATCCGCGTCTCCGACAACTTGCCGGTGAGTGGGCGCCCCGCGGTGGGGAGGGCGCGCCGGGCGGGGGG
CGCACGGGCGTGCTTTAGCCCGGACGAGGGAACCTGACGGAGACCCTGGGCTTCCAGGTGGCCATCAAACACGTGGAGAAGGACCGGATT
TCCGACTGGGGAGAGCTGGTGAGTGCCCTGCAGGAGCGACCCCCAGGATGAGTGGGTGGGGTGAGGGGCGCCCCCGACTCCCGCCCTAAC
GCGGCCCCCTCGCCCCTGCAGCCTAATGGCACTCGAGTGCCCATGGAAGTGGTCCTGCTGAAGAAGGTGAGCTCGGGTTTCTCCGGC-3'

[Top]

RS ID: 56213408 Link_out

Alleles: C/T

Validation:

  • By cluster

Details:

Chromosome Reference Position
6 37140899

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_002648 Link_out NP_002639 Link_out 3 D [Asp] / D [Asp]
near-gene-5 XM_002342627 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TATATACCACCCAGCTTCTTTGTGCTTGTTTTTGCTAAAAGTGTGTTTTCTCTTCTATTCCCTTGGCTCACAGGGACCCGAGTGTAT
AGCCCTCCAGAGTGGATCCGCTACCATCGCTACCATGGCAGGTCGGCGGCAGTCTGGTCCCTGGGGATCCTGCTGTATGATATGGTGTGT
GGAGATATTCCTTTCGAGCATGA C/T GAAGAGATCATCAGGGGCCAGGTTTTCTTCAGGCAGAGGGTCTCTTCAGGTAACTGATGGAA
ACCCCTGGCCATGGGGTTATTGGTCTTAATGGGGCTATTAGTCTTCATGGGACAGTCTTTGAAATTCTGGAGAGCTTCACTCTCCAGTAG
ATTCTGTCACCCTTGGCTTAGAATTGTAGGTGAGTGATTTACACTTGA-3'

[Top]

RS ID: 56008255 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
6 37140827

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_002648 Link_out NP_002639 Link_out 3 R [Arg] / R [Arg]
missense XM_002342627 Link_out XP_002342668 Link_out 1 P [Pro] / S [Ser]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CCCAGAGGGAAAAATGGAGTTCACCTAGCTCCTGAGAGAAGGGATTTTTTTTTTTTTTAAAAGAAAGAGTTATATATACCACCCAGC
TTCTTTGTGCTTGTTTTTGCTAAAAGTGTGTTTTCTCTTCTATTCCCTTGGCTCACAGGGACCCGAGTGTATAGCCCTCCAGAGTGGATC
CGCTACCATCGCTACCATGGCAG A/G TCGGCGGCAGTCTGGTCCCTGGGGATCCTGCTGTATGATATGGTGTGTGGAGATATTCCTTT
CGAGCATGACGAAGAGATCATCAGGGGCCAGGTTTTCTTCAGGCAGAGGGTCTCTTCAGGTAACTGATGGAAACCCCTGGCCATGGGGTT
ATTGGTCTTAATGGGGCTATTAGTCTTCATGGGACAGTCTTTGAAATT-3'

[Top]

RS ID: 55982566 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
6 37140785

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_002648 Link_out NP_002639 Link_out 3 Y [Tyr] / Y [Tyr]
intron XM_002342627 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GGGTTGGAGAGATGCCGTAAGGTGCGCCTCCACTCTCCTTAGCCCAGAGGGAAAAATGGAGTTCACCTAGCTCCTGAGAGAAGGGAT
TTTTTTTTTTTTTAAAAGAAAGAGTTATATATACCACCCAGCTTCTTTGTGCTTGTTTTTGCTAAAAGTGTGTTTTCTCTTCTATTCCCT
TGGCTCACAGGGACCCGAGTGTA C/T AGCCCTCCAGAGTGGATCCGCTACCATCGCTACCATGGCAGGTCGGCGGCAGTCTGGTCCCT
GGGGATCCTGCTGTATGATATGGTGTGTGGAGATATTCCTTTCGAGCATGACGAAGAGATCATCAGGGGCCAGGTTTTCTTCAGGCAGAG
GGTCTCTTCAGGTAACTGATGGAAACCCCTGGCCATGGGGTTATTGGT-3'

[Top]

RS ID: 55846955 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
6 37138909

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_002648 Link_out NP_002639 Link_out 3 G [Gly] / G [Gly]
intron XM_002342627 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GTGCTTTAGCCCGGACGAGGGAACCTGACGGAGACCCTGGGCTTCCAGGTGGCCATCAAACACGTGGAGAAGGACCGGATTTCCGAC
TGGGGAGAGCTGGTGAGTGCCCTGCAGGAGCGACCCCCAGGATGAGTGGGTGGGGTGAGGGGCGCCCCCGACTCCCGCCCTAACGCGGCC
CCCTCGCCCCTGCAGCCTAATGG C/T ACTCGAGTGCCCATGGAAGTGGTCCTGCTGAAGAAGGTGAGCTCGGGTTTCTCCGGCGTCAT
TAGGCTCCTGGACTGGTTCGAGAGGCCCGACAGTTTCGTCCTGATCCTGGAGAGGCCCGAGCCGGTGCAAGATCTCTTCGACTTCATCAC
GGAAAGGGGAGCCCTGCAAGAGGAGCTGGCCCGCAGCTTCTTCTGGCA-3'

[Top]

RS ID: 36084391 Link_out

Alleles: A/C

Validation:

  • By frequency
  • By cluster

Details:

Chromosome Reference Position
6 37141856

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_002648 Link_out NP_002639 Link_out 1 P [Pro] / T [Thr]
near-gene-5 XM_002342627 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TCCTATTGAAGGGTACCCAGCACAGTGTTCTAGAAAATGCTTGGCCTCCCTGGGACCCCAGACTTGTGGGCCTCTGAGAAGCAAATG
GGGAAGACCTTTGCAGTGTAAAAACAAGTYGAGTCATTCATAACCTCGTCTATCCTCCTTTCTGCAGAATGTCAGCATCTCATTAGATGG
TGCTTGGCCCTGAGACCATCAGATAGGCCAACCTTCGAAGAAATCCAGAACCATCCATGGATGCAAGATGTTCTCCTGCCCCAGGAAACT
GYTGAGATCCACCTCCACAGCCTGTCGCCGGGG A/C CCAGCAAATAGCAGCCTTTCTGGCWGGTCCTCCCCTCTCTTGTCAGATGCCC
GAGGGAGGGGAAGCTTCTGTCTCCAGCTTCCCGAGTACCAGTGACACGTCTCKMCAAGCAGGACAGTGCTTGATACAGGAACAACATTTA
CAACTCATTCCAGATCCCRGGCCCCTGGAGGCTGCMTCCCAACAGTGGGGAAGAGTGACTCTCCAGGGGTCCTAGGCCTCAACTCCTCCC
ATAGATACTCTCTTCTTCTCATAGGTGTCCAGCATTGCTGGACTCTGAAATATCCCGGGGGTGGGGGK-3'

[Top]

RS ID: 35760989 Link_out

Alleles: C/G

Validation:

  • By frequency
  • By cluster

Details:

Chromosome Reference Position
6 37139030

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
intron XM_002342627 Link_out Not Applicable Not Applicable Not Applicable
missense NM_002648 Link_out NP_002639 Link_out 1 E [Glu] / Q [Gln]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GCATCCGCGTCTCCGACAACTTGCCGGTGAGTGGGCGCCCCGCGGTGGGGAGGGCGCGCCGGGCGGGGGGCGCACGGGCGTGCTTTA
GCCCGGACGAGGGAACCTGACGGAGACCCTGGGCTTCCAGGTGGCCATCAAACACGTGGAGAAGGACCGGATTTCCGACTGGGGAGAGCT
GGTGAGTGCCCTGCAGGAGCGACCCCCAGGATGAGTGGGTGGGGTGAGGGGCGCCCCCGACTCCCGCCCTAACGCGGCCCCCTCGCCCCT
GCAGCCTAATGGCACTCGAGTGCCCATGGAAGTGGTCCTGCTGAAGAAGGTGAGCTCGGGTTTCTCCGGCGTCATTAGGCTCCTGGACTG
GTTCGAGAGGCCCGACAGTTTCGTCCTGATCCTGGAGAGGCCC C/G AGCCGGTGCAAGATCTCTTCGACTTCATCACGGAAAGGGGAG
CCCTGCAAGAGGAGCTGGCCCGCAGCTTCTTCTGGCAGGTGCTGGAGGCCGTGCGGCACTGCCACAACTGCGGGGTGCTCCACCGCGACA
TCAAGGACGAAAACATCCTTATCGACCTCAATCGCGGCGAGCTCAAGCTCATCGACTTCGGGTCGGGGGCGCTGCTCAAGGACACCGTCT
ACACGGACTTCGATGGTGAGCCAGGCCCGGGAGGGAGCTGCCCAGGTGACTCGGCCCGGCCCGGCCCAGTCCGGAGGCCTCGGCCAGTCT
CCCGCGCCAGCCTTTTGTAAAGGTCATTGGGCCGCCTGGCTCGATGCTAGCCGGGGTGGGACGCAGGAGAGCCTCCCAGCGTAGTAAA-3
'

[Top]

RS ID: 34095970 Link_out

Alleles: -/C

Validation:

Not Completed

Details:

Chromosome Reference Position
6 37138563

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
frameshift NM_002648 Link_out NP_002639 Link_out 1 Not Applicable
intron XM_002342627 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CCAGGCATAGCCTTCGGCACAGCCCCGGCTCCGGCTCCTGCGGCAGCTCCTCTGGGCACCGTCCCTGCGCCGACATCCTGGAGGTTG
GGATGCTCTTGTCCAAAATCAACTCGCTTGCCCACCTGCGCGCCGCGCCCTGCAACGACCTGCACGCCACCAAGCTGGCGCCCGGTGAGA
GCACCCCCCGCCTCCGGCCCGGGGATGCGGGGCGGCGGCGGGATCTCCTGGGTGGGGAGCTGGCGGCTCGCGGGCCGGCACTGAGTCCCC
GTGCTTCCCCCTTTCCTAGGCAAGGAGAAGGAG -/C CCCTGGAGTCGCAGTACCAGGTGGGCCCGCTACTGGGCAGCGGCGGCTTCGG
CTCGGTCTACTCAGGCATCCGCGTCTCCGACAACTTGCCGGTGAGTGGGCGCCCCGCGGTGGGGAGGGCGCGCCGGGCGGGGGGCGCACG
GGCGTGCTTTAGCCCGGACGAGGGAACCTGACGGAGACCCTGGGCTTCCAGGTGGCCATCAAACACGTGGAGAAGGACCGGATTTCCGAC
TGGGGAGAGCTGGTGAGTGCCCTGCAGGAGCGACCCCCAGGATGAGTGGGTGGGGTGAGGGGCGCCCC-3'

[Top]

RS ID: 33989191 Link_out

Alleles: C/G

Validation:

  • By frequency
  • By cluster

Details:

Chromosome Reference Position
6 37139086

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
intron XM_002342627 Link_out Not Applicable Not Applicable Not Applicable
missense NM_002648 Link_out NP_002639 Link_out 3 E [Glu] / D [Asp]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GATTTCCGACTGGGGAGAGCTGGTGAGTGCCCTGCAGGAGCGACCCCCAGGATGAGTGGGTGGGGTGAGGGGCGCCCCCGACTCCCG
CCCTAACGCGGCCCCCTCGCCCCTGCAGCCTAATGGCACTCGAGTGCCCATGGAAGTGGTCCTGCTGAAGAAGGTGAGCTCGGGTTTCTC
CGGCGTCATTAGGCTCCTGGACTGGTTCGAGAGGCCCGACAGTTTCGTCCTGATCCTGGAGAGGCCCGAGCCGGTGCAAGATCTCTTCGA
CTTCATCACGGAAAGGGGAGCCCTGCAAGAGGA C/G CTGGCCCGCAGCTTCTTCTGGCAGGTGCTGGAGGCCGTGCGGCACTGCCACA
ACTGCGGGGTGCTMCACCGCGACATCAAGGACGAAAACATCCTTATCGACCTCAATCGCGGCGAGCTCAAGCTCATCGACTTCGGGTCGG
GGGCGCTGCTCAAGGACACCGTCTACACGGACTTCGATGGTGAGCCAGGCCCGGGAGGGAGCTGCCCAGGTGACTCGGCCCGGCCCGGCC
CAGYCCGGAGGCCTCGGCCAGTCTCCCGCGCCAGCCTTTTGTAAAGGTCATTGGGCCGCCTGGCTCGA-3'

[Top]

RS ID: 9349029 Link_out

Alleles: C/T

Validation:

  • By hap map

Details:

Chromosome Reference Position
6 37141824

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_002648 Link_out NP_002639 Link_out 2 A [Ala] / V [Val]
near-gene-5 XM_002342627 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GGCCTCTGAGAAGCAAATGGGGAAGACCTTTGCAGTGTAAAAACAAGTTGAGTCATTCATAACCTCGTCTATCCTCCTTTCTGCAGA
ATGTCAGCATCTCATTAGATGGTGCTTGGCCCTGAGACCATCAGATAGGCCAACCTTCGAAGAAATCCAGAACCATCCATGGATGCAAGA
TGTTCTCCTGCCCCAGGAAACTG C/T TGAGATCCACCTCCACAGCCTGTCGCCGGGGCCCAGCAAATAGCAGCCTTTCTGGCAGGTCC
TCCCCTCTCTTGTCAGATGCCCGAGGGAGGGGAAGCTTCTGTCTCCAGCTTCCCGAGTACCAGTGACACGTCTCGCCAAGCAGGACAGTG
CTTGATACAGGAACAACATTTACAACTCATTCCAGATCCCAGGCCCCT-3'

[Top]

RS ID: 1050852 Link_out

Alleles: A/C

Validation:

  • By cluster

Details:

Chromosome Reference Position
6 37139152

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_002648 Link_out NP_002639 Link_out 3 L [Leu] / L [Leu]
intron XM_002342627 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GTTTCTCCGGCGTCATTAGGCTCCTGGACTGGTTCGAGAGGCCCGACAGTTTCGTCCTGATCCTGGAGAGGCCCGAGCCGGTGCAAG
ATCTCTTCGACTTCATCACGGAAAGGGGAGCCCTGCAAGAGGASCTGGCCCGCAGCTTCTTCTGGCAGGTGCTGGAGGCCGTGCGGCACT
GCCACAACTGCGGGGTGCT A/C CACCGCGACATCAAGGACGAAAACATCCTTATCGACCTCAATCGCGGCGAGCTCAAGCTCATCGAC
TTCGGGTCGGGGGCGCTGCTCAAGGACACCGTCTACACGGACTTCGATGGTGAGCCAGGCCCGGGAGGGAGCTGCCCAGGTGACTCGGCC
CGGCCCGGCCCAGYC-3'

[Top]

RS ID: 262937 Link_out

Alleles: A/G

Validation:

  • By cluster

Details:

Chromosome Reference Position
6 37138305

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense XM_002342627 Link_out XP_002342668 Link_out 2 A [Ala] / V [Val]
utr-5 NM_002648 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CCGCCTCCCCTCACGCCCCGCGCCCCTCCCCCTCCATTTTGGCGCCTTTTCCTTCCCGCCACGTCGTGGCGGCGTAGAGACCATTCT
GACCGCGAGAGCTgggcggggcgggggcggggcgcgccgAGTTATGCAGATCAATCGGCCTCTGGTTGGCTGGAGTAGCGCTGGCAgggg
cggggccggggcgcggccacagagcgcgcggggcgggggccgAGGGGAGTcgcccagtcccgccgcttccccaccccctctcctccctcg
gccggcccggcagccctgctccccgccttggcctcccggagaggccccgccccgtccccgcccgccgcgccctccccgcgcgccctcccc
gccggcgcgctcctccccTTTACTCCTGGCTGCGGGGCGAGCCGGGCGTCTGCTGCAGCGGCCGCGGTGGCTGAGGAGGCCCGAGAGGAG
TCGGTGgcagcggcggcggcgggaccggcagcagcagcagcagcagcagcagcagcaACCACTAGCCTCCTGCCCCGCGGCGCTGCCGCA
CGAGCCCCACGAGCCGCTCACCCCGCCGTTCTCAGCGCTGCCCGACCCCGCTGGCGCGCCCTCCCGCCGCCAGTCCCGGCAGCGCCCTCA
GTTGTCCTCCGACTCGCCCTCGGCCTTCCGCGccagccgcagccacagccgcaacgccacccgcagccacagccacagccacagccccag
GCATAGCCTTCGGCACAGCCCCGGCTCCGGCTCCTGCG A/G CAGCTCCTCTGGGCACCGTCCCTGCGCCGACATCCTGGAGGTTGGGA
TGCTCTTGTCCAAAATCAACTCGCTTGCCCACCTGCGCGCCGCGCCCTGCAACGACCTGCACGCCACCAAGCTGGCGCCCGGTGAGAGCA
CCCCCCGCCTCCGGCCCGGGGATGCGGGGCGGCGGCGGGATCTCCTGGGTGGGGAGCTGGCGG-3'

[Top]

RS ID: 262936 Link_out

Alleles: C/G

Validation:

  • By frequency
  • By 2 hit 2 allele

Details:

Chromosome Reference Position
6 37138220

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous XM_002342627 Link_out XP_002342668 Link_out 3 V [Val] / V [Val]
utr-5 NM_002648 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CCGCCTCCCCTCACGCCCCGCGCCCCTCCCCCTCCATTTTGGCGCCTTTTCCTTCCCGCCACGTCGTGGCGGCGTAGAGACCATTCT
GACCGCGAGAGCTgggcggggcgggggcggggcgcgccgAGTTATGCAGATCAATCGGCCTCTGGTTGGCTGGAGTAGCGCTGGCAgggg
cggggccggggcgcggccacagagcgcgcggggcgggggccgAGGGGAGTcgcccagtcccgccgcttccccaccccctctcctccctcg
gccggcccggcagccctgctccccgccttggcctcccggagaggccccgccccgtccccgcccgccgcgccctccccgcgcgccctcccc
gccggcgcgctcctccccTTTACTCCTGGCTGCGGGGCGAGCCGGGCGTCTGCTGCAGCGGCCGCGGTGGCTGAGGAGGCCCGAGAGGAG
TCGGTGgcagcggcggcggcgggaccggcagcagcagcagcagcagcagcagcagcaACCACTAGCCTCCTGCCCCGCGGCGCTGCCGCA
CGAGCCCCACGAGCCGCTCACCCCGCCGTTCTCAGCGCTGCCCGACCCCGCTGGCGCGCCCTCCCGCCGCCAGTCCCGGCAGCGCCCTCA
GTTGTCCTCCGACTCGCCCTCGGCCTTCCGCGccagccgcagc C/G acagccgcaacgccacccgcagccacagccacagccacagcc
ccagGCATAGCCTTCGGCACAGCCCCGGCTCCGGCTCCTGCGGCAGCTCCTCTGGGCACCGTCCCTGCGCCGACATCCTGGAGGTTGGGA
TGCTCTTGTCCAAAATCAACTCGCTTGCCCACCTGCGCGCCGCGCCCTGCAACGACCTGCACGCCACCAAGCTGGCGCCCGGTGAGAGCA
CCCCCCGCCTCCGGC-3'