SNPJam Report for PDXP

Showing coding SNPs for PDXP (Gene ID: 57026)

Show all SNPs for this gene at dbSNP

This SNP viewer is in beta and your feedback is appreciated!

This SNPJam view is a snapshot of the information available at dbSNP and HapMap. It has been reformated to include the information most relevant to drug and metabolomics research.

Please note that population frequency data is updated on a nightly basis and may not be present if this gene was recently annotated.

Show all non-coding SNPs

[Top]

RS ID: 35046948 Link_out

Alleles: -/A

Validation:

Not Completed

Details:

Chromosome Reference Position
22 38061677

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
frameshift NM_020315 Link_out NP_064711 Link_out 3 P [Pro] / P [Pro]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AGATGCCGGCATCTGGTTGCCGTCTCTACCCTTAACCACTACAGTGAGACTCGGAAGTGGGCTTTCTGGCTCGTGTCAGCAGCCGAT
TTGACCCTGGCACAATCCACCTCCCTGGACTTCCAGTTTCAGGGCCTGACGCTGTCCCTGCCGCCCTCCTGCTGACTGCGTCTCCATCTC
CCTACAGGCACCGGGAGCCTGGCCGCTGCAGTGGAGACAGCCTCGGGACGCCAGGCCCTGGTGGTGGGCAAGCCCAGCCCCTACATGTTC
GAGTGCATCACGGAGAACTTCAGCATCGACCCC -/A GCACGCACGCTTATGGTGGGTGACCGCCTGGAGACCGACATCCTCTTTGGCC
ACCGCTGCGGCATGACCACTGTGCTCACGCTCACAGGAGTCTCCCGCCTAGAAGAGGCCCAGGCCTACCTAGCGGCCGGCCAGCACGACC
TCGTGCCCCATTACTATGTGGAGAGCATCGCAGACTTGACAGAGGGGTTGGAGGACTGAGCCCACTGCACCTGCAGCCACAGGCCCACCC
CTCCCCACTCCCTGATCCCGTAGGTGGAGGCGATGGGTCACGAGCCATGTTAAGCACAACCGGCTCCT-3'