SNPJam Report for MTF1

Showing coding SNPs for MTF1 (Gene ID: 4520)

Show all SNPs for this gene at dbSNP

This SNP viewer is in beta and your feedback is appreciated!

This SNPJam view is a snapshot of the information available at dbSNP and HapMap. It has been reformated to include the information most relevant to drug and metabolomics research.

Please note that population frequency data is updated on a nightly basis and may not be present if this gene was recently annotated.

Show all non-coding SNPs

[Top]

RS ID: 116355159 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
1 38280953

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_005955 Link_out NP_005946 Link_out 2 D [Asp] / G [Gly]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TACCTCATGCCTCCTGCTCACCCGCTTTTCCCAGAGGTGAGCACACATGGGCCCTTCACTTGGAGAAGCTGCTGGTGAGGCCCATCT
CCTCCTCCCCCTGCAGTAGTGCTTCAATGGGAATCAGATTGGACGGGGTGTCCAGGCTCTGGAGGGATAGAAACTCTGACACATCCATGG
CACTTAATGTTTCTGTCTGAGGG C/T CTGAAGGAGTCTCTGCTTGTCGGCTTTGCTCACAGGAGGAGGGCAAGGTAGAGGATGATGAC
CCGGGAACAGGGGCTGAAGAGAAAGTCTGCGCTGGGAGCTGCAGGCTGGGCCCATCAGGAGCCTGGGGGCTCGGCTCTGGAGGGGGTGGG
GAGGAGCAGCCCTTTCTCCTGCTGGATGCCCGCTCCTTTGCAGAGTCC-3'

[Top]

RS ID: 116143945 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
1 38280907

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_005955 Link_out NP_005946 Link_out 3 L [Leu] / L [Leu]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AGATTTCTTCATCCTTCAAATTTCTGACCCATGATGGCAGGCATTGTACCTCATGCCTCCTGCTCACCCGCTTTTCCCAGAGGTGAG
CACACATGGGCCCTTCACTTGGAGAAGCTGCTGGTGAGGCCCATCTCCTCCTCCCCCTGCAGTAGTGCTTCAATGGGAATCAGATTGGAC
GGGGTGTCCAGGCTCTGGAGGGA C/T AGAAACTCTGACACATCCATGGCACTTAATGTTTCTGTCTGAGGGTCTGAAGGAGTCTCTGC
TTGTCGGCTTTGCTCACAGGAGGAGGGCAAGGTAGAGGATGATGACCCGGGAACAGGGGCTGAAGAGAAAGTCTGCGCTGGGAGCTGCAG
GCTGGGCCCATCAGGAGCCTGGGGGCTCGGCTCTGGAGGGGGTGGGGA-3'

[Top]

RS ID: 113539147 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
1 38304302

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_005955 Link_out NP_005946 Link_out 3 P [Pro] / P [Pro]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AGTAAGGATGTTCTTGGACTCCATCAGCACCCCTCTAATCTGCAGTGGTTGGTTATAGCTGTCCTGGGGTGAGCTAACACTGCTAAA
TCAAGAGCTAGTAAAGGGAGTTTTCTTTCTTTTTTGAAAAATTCCAGAGTATATCAAGACCCCCAGCTGAAACCTGGTCAGTGACAAATA
GAAAACAGTAAGACCTACCGAAA C/T GGCTTTTCCCCTGTATGAGTTCGAATGTGCTTCCTCAGATCACTGAGTGTGGTGAAGTATTT
GCTGCAGCCTTCAGATTCACAGTTAAACGTTTTCCCTGTGTGAAGCCTCTGATGTGCTTTCAGCCTGCAAAATATTCCAGAAAAATTCCC
TTTGTCATAAAATTCTTTTTTTTTTTTTTTTTTTTTTCTGAGACAGAG-3'

[Top]

RS ID: 112642117 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
1 38297918

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_005955 Link_out NP_005946 Link_out 2 T [Thr] / M [Met]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GTCAAAAGGAATCAGGCATCAGAGAGAACAGGCTCTAATAGAACTCTTATCAGAAGAAGAAAAAATCCTACATGGTCAGTAATTAAA
CACAATTAAATTTAGAAAACTTCAAAGACTGGCCTGCCTCAATTTTCCCACCAAAGGGAGTGCTTAATTCTTGCCCTTATTTTTCTAGCA
CTGGTATTACAGGTACACTTACC A/G TACTGGAATTTTCTCGCAATTCAGAATCTGTGGACAGAAGGCTCAAGTCACTTAGACAAAGT
GAGTGATTTGTATCCTGTGAAAGAGAAAAAATTCTAATTGAGTAACAAAAATCAGGATTTACAGTGGCATATCATGTAACAAAACATTTG
ATTACAAAGTCCCTAATGTTCCACATGTCTACATGTATTATCTGAAGA-3'

[Top]

RS ID: 79661501 Link_out

Alleles: A/G

Validation:

  • By cluster

Details:

Chromosome Reference Position
1 38301400

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_005955 Link_out NP_005946 Link_out 1 C [Cys] / R [Arg]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AACATTCTAGGTAAGGCTGAGCTAATTATGCTCACCTGAATATATACAGGATCTATATCTCTGTATATCCACCTAGCTCTACAGGTC
TCAATGGAAAATTGATAGTTACAGGCTTGATGAAACAAAAATTGGCCTAAACTCACCAGTATGTGTACGAACGTGAGTTTTAAGGTGGTG
GCTTGCTGCAAATGCTTTTCCAC A/G GCCATCGTGATCGCACCTAAATTTGTTAAGGAAAGAGAAACAGGAGTCATTAGCTAATAGAT
CTTTATCCTGAACGTCTTTTTTTTTTTTGAGATCGAGTCTCGCTCTGTCCCCAAGGCTGGAGTGCAGTGGCGCAATCTTGGCTCACTGCA
AGCTCCACCTCCCGGGTTCATGCCATTCTCCTGCCTCAGCCTCCCGAG-3'

[Top]

RS ID: 79630033 Link_out

Alleles: A/G

Validation:

  • By cluster

Details:

Chromosome Reference Position
1 38289462

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_005955 Link_out NP_005946 Link_out 2 T [Thr] / I [Ile]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CTTTCTGACCCTTTATAGAAAGCTCACTTCATTTACGCTAACTAGAATGATTCATTGTGCCTGTGACTCAGTGTGTCAGCAAGTGCT
TAGATGTGAGTAGAAAGAGTCCGTGTGACAAACCTGTCTGTTGAGGATCTTCCTGAATTGCCGTATCATCTGAATTCTGGAACATTGATT
CAAAGATGATTGCTGGTGAAATT A/G TGCTGAGGTCCTGGCCCTGGGTCTGATGGAGAGAGACAAAGATGTGAGATTGGCCATCTTGA
GACAATTCTTCACCATGAGAAAACACATTCAAAGCAGCAGAACTAGAATGAAAATCTTTTGATATGCATTTTGTTTCTACCTTCTGCTAT
TTAAAGTAACATGTATTTTCTTAAGCCTTAGACACTAAAGATTTGGGT-3'

[Top]

RS ID: 74537935 Link_out

Alleles: C/T

Validation:

  • By frequency
  • By cluster

Details:

Chromosome Reference Position
1 38300851

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_005955 Link_out NP_005946 Link_out 2 E [Glu] / G [Gly]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AACAGATATACAGAGAAGACATTTTAACCTTTGATTGTGATACACAAACAACTGTTGAAGTTCTATGGTACCCAGATCAAGAGACAA
AAACACTACACACCTCTGATCCATTGTGTTGTGGAAGTGCATTGTATGAGTGTCCTTTGTTATCATGACCTTTCATGTGACTTTTGAGAC
TGTATTGAGTGCTGAATGTTTTC C/T CACAGCCATTACTGGGGCAGAAGAAGGGTCTTTCACCTGCAAGAATAACAAAGTAGTGTTAA
TTTACCATAAAGTCATTTCACTGGATTAAGAAATCTACCTTTCCCTAATAGAGGTAAGTAAGTATTTTTAAGAGAGTTTGGGTAACAGTT
GTTAAAAGTTCAATAAATTACACATTAATCATCTCAGTCCTCAAACTC-3'

[Top]

RS ID: 61734999 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
1 38288242

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_005955 Link_out NP_005946 Link_out 1 P [Pro] / A [Ala]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AGCTTGCTGGGAGCCAGGTCCTAGGGAGGGAGCAGGCGGAGGAGCAGACG A/G AGCTGAGGCAGGTAGTAGAGGCTGGGGTGGCT
CGGAGAGGCCAGGTTGCA-3'

[Top]

RS ID: 55657683 Link_out

Alleles: C/T

Validation:

  • By cluster

Details:

Chromosome Reference Position
1 38287849

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_005955 Link_out NP_005946 Link_out 1 N [Asn] / D [Asp]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TACAATTTGTTCTTGGTTTTGTGGAGAACTGGTGGCACCATTTAATATCCATTGTAAGT C/T CTGTTCTCCCATGACTAGGCTGG
ACTGCAGGATAGCTGTGTTGGGAGTTGG-3'

[Top]

RS ID: 41267341 Link_out

Alleles: G/T

Validation:

Not Completed

Details:

Chromosome Reference Position
1 38323142

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_005955 Link_out NP_005946 Link_out 3 D [Asp] / E [Glu]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TATACAAACCAAAAGTTCCAGAAGCAATCACAACAAAACCTGAGGCATATGTTGTTGATAGCAAAACTACTTAAGTCCTAACCCCAT
GCACTCCTTTACTCCCCAGCTAAAATTTGCACCAAGAATTTTGTAAGGACTTGCCCCAAAACCAAACTAGGCCCTCACTGACTGCTTTAC
TTACTTCTTTACGTTTTGTTTCCGGACATTCCGACTGCAGAGTGAGGGTTGCACCTTCAATATTTCTTGGCATGGGTGTGGAACCAGGGT
TTATTGTCAAATGAATCTGATCTGGTGAGATAATGTGCTGCACATAACCCTGGGACATTGCTTCATGATCTATCAGGTGAAAGCCCTCTT
CACCCCCTACTAGAAAAGGCAAGTGTTCTCCGCACTGTCCGTC G/T TCATCTTCATCCTCCAAAGTGCCAGGGTCCTGCTCAATAAGA
ACAGTGGTCCTATCATAAACAGTTCCAGATGAGGAAGGCACCAGTCCGTTTTTATCCACAAACCTGAGCATTTTATCATCGGGGGTCAGC
TCATCTTCCTCTGCCTCAAAGTAGATGATGTTGTTGTCTGGACTGTGTTCCCCCATGGTTCAGTTGTGCTCAGCCCAGTTGTGAGAAATG
AAAACGTAATGACTTGTCTGCAACAGAACAAAGCCAGAGTTAGAGTCATACCACAAGACCGACGGACCTCCTCAGCAACCACAAGGCTCA
TTTTCCCTCTCACTTAAAGAGCAAGCCAAAGCAAATGAAAAACCATCCTTGGGAATAATTTTTTTATTTTAACTTTAAAACCATCAAG-3
'

[Top]

RS ID: 34601508 Link_out

Alleles: -/G

Validation:

Not Completed

Details:

Chromosome Reference Position
1 38280960

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
frameshift NM_005955 Link_out NP_005946 Link_out 1 Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GATGTGAATAAAGAAAATACGTCTGAAAGGTGAGGATTTCAAACAGTAGATTTCTTCATCCTTCAAATTTCTGACCCATGATGGCAG
GCATTGTACCTCATGCCTCCTGCTCACCCGCTTTTCCCAGAGGTGAGCACACATGGGCCCTTCACTTGGAGAAGCTGCTGGTGAGGCCCA
TCTCCTCCTCCCCCTGCAGTAGTGCTTCAATGGGAATCAGATTGGACGGGGTGTCCAGGCTCTGGAGGGATAGAAACTCTGACACATCCA
TGGCACTTAATGTTTCTGTCTGAGGGTCTGAAG -/G AGTCTCTGCTTGTCGGCTTTGCTCACAGGAGGAGGGCAAGGTAGAGGATGAT
GACCCGGGAACAGGGGCTGAAGAGAAAGTCTGCGCTGGGAGCTGCAGGCTGGGCCCATCAGGAGCCTGGGGGCTCGGCTCTGGAGGGGGT
GGGGAGGAGCAGCCCTTTCTCCTGCTGGATGCCCGCTCCTTTGCAGAGTCCCGGCATGCACACTGACACTGACATGCCTCTTCTTGTTTG
ATGATGATCACAGGAACACTGAGGCCAATCTGCTGGACAGAGCTCCCTGCGAGAGAGGCAAGAGAGAC-3'

[Top]

RS ID: 28477919 Link_out

Alleles: G/T

Validation:

  • By cluster

Details:

Chromosome Reference Position
1 38281114

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_005955 Link_out NP_005946 Link_out 3 G [Gly] / G [Gly]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TCTGACACATCCATGGCACTTAATGTTTCTGTCTGAGGGTCTGAAGGAGTCTCTGCTTGTCGGCTTTGCTCACAGGAGGAGGGCAAG
GTAGAGGATGATGACCCGGGAACAGGGGCTGAAGAGAAAGTCTGCGCTGGGAGCTGCAGGCTGGGCCCATCAGGAGCCTGGGGGCTCGGC
TCTGGAGGGGGTGGGGAGGAGCA G/T CCCTTTCTCCTGCTGGATGCCCGCTCCTTTGCAGAGTCCCGGCATGCACACTGACACTGACA
TGCCTCTTCTTGTTTGATGATGATCACAGGAACACTGAGGCCAATCTGCTGGACAGAGCTCCCTGCGAGAGAGGCAAGAGAGACTGCTCT
TCAAGTAGCTGCAGGGGCAGGAGCATGAGGGACAGGGATACATGGACT-3'

[Top]

RS ID: 12751325 Link_out

Alleles: C/T

Validation:

  • By frequency
  • By cluster

Details:

Chromosome Reference Position
1 38289383

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_005955 Link_out NP_005946 Link_out 3 T [Thr] / T [Thr]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CCCATCTGGGTGACAAAATGAGACGCTGTCTCAAAAAAAAAAAATGTAGAAGAAAAATCTCACAGCTCCTCCCCATTTTGGTGGTTT
TACAGCCAACAGAAGATTCTGGGAAAGGAGATTCTCTTCTTCAGGACTGAGGGAAGTAGGGGAAAAGATGGAATTAAACTGAAAGACCCA
AACTTTCTGACCCTTTATAGAAAGCTCACTTCATTTACGCTAACTAGAATGATTCATTGTGCCTGTGACTCAGTGTGTCAGCAAGTGCTT
AGATGTGAGTAGAAAGAGTCCGTGTGACAAACC C/T GTCTGTTGAGGATCTTCCTGAATTGCCGTATCATCTGAATTCTGGAACATTG
ATTCAAAGATGATTGCTGGTGAAATTGTGCTGAGGTCCTGGCCCTGGGTCTGATGGAGAGAGACAAAGATGTGAGATTGGCCATCTTGAG
ACAATTCTTCACCATGAGAAAACACATTCAAAGCAGCAGAACTAGAATGAAAATCTTTTGATATGCATTTTGTTTCTACCTTCTGCTATT
TAAAGTAACATGTATTTTCTTAAGCCTTAGACACTAAAGATTTGGGTCCTCAAATACTTTATTTTTAT-3'

[Top]

RS ID: 9729276 Link_out

Alleles: A/G

Validation:

  • By cluster

Details:

Chromosome Reference Position
1 38288227

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_005955 Link_out NP_005946 Link_out 1 P [Pro] / S [Ser]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TGCCGCTGCTGATGCAGAAGCCCCAGCAACAACAGAAAGTCCTGGTACAATGGGCTGCGGTGCCTGGGGGTGCGGAAGAAACTCTTG
ATGATTAGCAGCAAACTGTGTGCTGTGGGGAACAGGCACTTCTGGAGGTTGTAAGAGAGCAGGGGGGTTGCCAAATGCAGCTTGCTGGGA
GCCAGGTCCTAGGGAGGGAGCAG A/G CGGAGGAGCAGACGGAGCTGAGGCAGGTAGTAGAGGCTGGGGTGGCTCGGAGAGGCCAGGTT
GCAGTACAAGTGGAAGAGATAAAGATGCTGAATTTCCTGTGGATGGCGGAACATCACTGACTGACTCTGCATCACCATTAAAACTTTCAG
TCAAGGAAGCTGGCAAGAAAAAGAAATAGAAATATATATACATATCCC-3'

[Top]

RS ID: 2228272 Link_out

Alleles: A/G

Validation:

  • By frequency

Details:

Chromosome Reference Position
1 38288390

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_005955 Link_out NP_005946 Link_out 3 T [Thr] / T [Thr]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CTTGAGCCTTCTGTCCACAGATTCTGAATTGCGAGAAAATTCCAGTACGACCCAGGGCCAGGACCTCAGCACAATTTCACCAGCAAT
CATCTTTGAATCAATGTTCCAGAATTCAGATGATACGGCAATTCAGGAAGATCCTCAACAGAC A/G GCTTCCTTGACTGAAAGTTTTA
ATGGTGATGCAGAGTCAGTCAGTGATGTTCCGCCATCCACAGGAAATTCAGCATCTTTATCTCTTCCACTTGTACTGCAACCTGGCCTCT
CCGAGCCACCCCAGCCTCTACTACCTGCCTCAGCTCCG-3'