SNPJam Report for HRH3

Showing coding SNPs for HRH3 (Gene ID: 11255)

Show all SNPs for this gene at dbSNP

This SNP viewer is in beta and your feedback is appreciated!

This SNPJam view is a snapshot of the information available at dbSNP and HapMap. It has been reformated to include the information most relevant to drug and metabolomics research.

Please note that population frequency data is updated on a nightly basis and may not be present if this gene was recently annotated.

Show all non-coding SNPs

[Top]

RS ID: 61729552 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
20 60791235

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_007232 Link_out NP_009163 Link_out 1 V [Val] / F [Phe]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CGAGTTGGCCCACAGGAGCCAGAAGGAGGTTTCGTACCAGTAGTCAGGGA A/G GCAGTGGCCATGGCAGGCGGCCCGGATGATCA
TCAGCAGCGTGTATGGGG-3'

[Top]

RS ID: 41284986 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
20 60791866

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_007232 Link_out NP_009163 Link_out 3 S [Ser] / S [Ser]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TCGAGGAGCTGCCGGAGCTGGAGGTGGGTGAAGCCACGGAGCCGCCCCCACCGCCACCCCCGAGGGTCGCCTCCCCGGCCTCAGCGC
CTACGGCCGCCTCACCCACCCCATACCTGTGCAGCGGCATGGCCTCCCCGTGCCCCTTCTGCCAGCAGCCCCAGCAGCCAGGCGGTGGGG
GTGGTGAGGGCTGGGCCTCGGGAGGGGGCTCGGGGCCGGCTGCCTCTCGAGCCCCATCCAGCCGGAGGCGGGTGCGCCTCTGGATGTTCA
GGTAGATGCTGAGGTTAAAGAAGGTGACGCTGAGGAAGGGCGTAAAGAACTCCAGGGTGGAAGCCGTGATGAGGAAGTACCAGTTGTAGA
AGAACTCGGCATAGCAGTGGCCCTCGGGGATGGAGCTGCCCCC A/G GACAGGTACTCCCAGCTCAGGATGGCTGGTCCGTACAGCAGG
AAGGCCAGCACCCACACCAGCAGCATCTTCCGCACTGCCCGCCGCGTGTCACCCTGCTGGGCCCGGTATGAGACCTGCAGAAGGGCAGGC
TGGTCAGGGGCGGGGCGGAAGGAATATTGGGCTGGGTGCGCCCCCGTAGCCTGTGGGCCCCTATGTGGGCCCTTCCCTCAGCAGCAATGC
TCCTCCTTTCCCCTCCTGTCCTCCCTCCCTCCCTCTTTCCCCTCCCTTCCTCTAACCCTCCCCACTGGGGTCCCGGACTGGTGCCCTGCC
ACACTCAGTGAGAGCCTCAGAAGCTCCCTGGGACCAACCTGAACCCTCACTCTCTGCTAGGCTGCCTGTTTACCACCCCCTACCAGCT-3
'

[Top]

RS ID: 3787430 Link_out

Alleles: C/T

Validation:

  • By frequency
  • By 2 hit 2 allele
  • By cluster

Details:

Chromosome Reference Position
20 60791422

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_007232 Link_out NP_009163 Link_out 3 P [Pro] / P [Pro]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GCTGAGAGAGGCGTGGCTGAGGGAGGCTCTGGTGGGCCACTCACTTCCAGCAGTGCTCCAGGGAGCTGTGGGGCTGGATTTTGAGCT
TCTGGGGGCAGAGCAGCTTGGTGAAGGCCCGGCGGAAGCTGTGGTGGCACAGAGGGTAGAGGACAGGGTTGACAGCCGAGTTGGCCCACA
GGAGCCAGAAGGAGGTTTCGTACCAGTAGTCAGGGACGCAGTGGCCATGGCAGGCGGCCCGGATGATCATCAGCAGCGTGTATGGGGCCC
AGCAGAGCCCAAAGATGCTCACGATGACGGCCAGCGACTTGGCCACTTTCCTGTCCCGAGACAGCCGAAAGCGCTGGGTGAAGCTCTGGG
ACACCATCTTCATGCGCTTCTCCAGCGAGGCCGAGGACGCCGA C/T GGCTTGGAGCCCCTCTTGAGTGAGCGCGGCCTCTCAGTGCCC
CTCGAGGAGCTGCCGGAGCTGGAGGTGGGTGAAGCCACGGAGCCGCCCCCACCGCCACCCCCGAGGGTCGCCTCCCCGGCCTCAGCGCCT
ACGGCCGCCTCACCCACCCCATACCTGTGCAGCGGCATGGCCTCCCCGTGCCCCTTCTGCCAGCAGCCCCAGCAGCCAGGCGGTGGGGGT
GGTGAGGGCTGGGCCTCGGGAGGGGGCTCGGGGCCGGCTGCCTCTCGAGCCCCATCCAGCCGGAGGCGGGTGCGCCTCTGGATGTTCAGG
TAGATGCTGAGGTTAAAGAAGGTGACGCTGAGGAAGGGCGTAAAGAACTCCAGGGTGGAAGCCGTGATGAGGAAGTACCAGTTGTAGA-3
'

[Top]

RS ID: 3787429 Link_out

Alleles: C/T

Validation:

  • By cluster
  • By frequency
  • By 2 hit 2 allele
  • By hap map

Details:

Chromosome Reference Position
20 60791404

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_007232 Link_out NP_009163 Link_out 3 S [Ser] / S [Ser]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GATGCCCAGGAGACCTGGGCTGAGAGAGGCGTGGCTGAGGGAGGCTCTGGTGGGCCACTCACTTCCAGCAGTGCTCCAGGGAGCTGT
GGGGCTGGATTTTGAGCTTCTGGGGGCAGAGCAGCTTGGTGAAGGCCCGGCGGAAGCTGTGGTGGCACAGAGGGTAGAGGACAGGGTTGA
CAGCCGAGTTGGCCCACAGGAGCCAGAAGGAGGTTTCGTACCAGTAGTCAGGGACGCAGTGGCCATGGCAGGCGGCCCGGATGATCATCA
GCAGCGTGTATGGGGCCCAGCAGAGCCCAAAGATGCTCACGATGACGGCCAGCGACTTGGCCACTTTCCTGTCCCGAGACAGCCGAAAGC
GCTGGGTGAAGCTCTGGGACACCATCTTCATGCGCTTCTCCAG C/T GAGGCCGAGGACGCCGACGGCTTGGAGCCCCTCTTGAGTGAG
CGCGGCCTCTCAGTGCCCCTCGAGGAGCTGCCGGAGCTGGAGGTGGGTGAAGCCACGGAGCCGCCCCCACCGCCACCCCCGAGGGTCGCC
TCCCCGGCCTCAGCGCCTACGGCCGCCTCACCCACCCCATACCTGTGCAGCGGCATGGCCTCCCCGTGCCCCTTCTGCCAGCAGCCCCAG
CAGCCAGGCGGTGGGGGTGGTGAGGGCTGGGCCTCGGGAGGGGGCTCGGGGCCGGCTGCCTCTCGAGCCCCATCCAGCCGGAGGCGGGTG
CGCCTCTGGATGTTCAGGTAGATGCTGAGGTTAAAGAAGGTGACGCTGAGGAAGGGCGTAAAGAACTCCAGGGTGGAAGCCGTGATGA-3
'

[Top]

RS ID: 2067476 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
20 60791185

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_007232 Link_out NP_009163 Link_out 3 S [Ser] / S [Ser]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CGTCCTCGGCCTCGCTGGAGAAGCGCATGAAGATGGTGTCCCAGAGCTTCACCCAGCGCTTTCGGCTGTCTCGGGACAGGAAAGTGG
CCAAGTCGCTGGCCGTCATCGTGAGCATCTTTGGGCTCTGCTGGGCCCCATACACGCTGCTGATGATCATCCGGGCCGCCTGCCATGGCC
ACTGCGTCCCTGACTACTGGTACGAAACCTCCTTCTGGCTCCTGTGGGCCAACTC A/G GCTGTCAACCCTGTCCTCTACCCTCTGTGC
CACCACAGCTTCCGCCGGGCCTTCACCAAGCTGCTCTGCCCCCAGAAGCTCAAAATCCAGCCCCACAGCTCCCTGGAGCACTGCTGGAAG
TGAGTGGCCCACCAGAGCCTCCCTCAGCCACGCCTCTCTCAGCCCAGGTCTCCTGGGCATCTGGCCCTGCTGCCCCCTACCCGGCTCGTT
CCCCCAGGGGTGAGCCCCGCCGTGTCTGTG-3'