SNPJam Report for HDAC1

Showing coding SNPs for HDAC1 (Gene ID: 3065)

Show all SNPs for this gene at dbSNP

This SNP viewer is in beta and your feedback is appreciated!

This SNPJam view is a snapshot of the information available at dbSNP and HapMap. It has been reformated to include the information most relevant to drug and metabolomics research.

Please note that population frequency data is updated on a nightly basis and may not be present if this gene was recently annotated.

Show all non-coding SNPs

[Top]

RS ID: 1140673 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
1 32797396

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_004964 Link_out NP_004955 Link_out 2 K [Lys] / R [Arg]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GGACGCCATCCCTGAGGAGAGTGGCGATGAGGACGAAGACGACCCTGACA A/G GCGCATCTCGATCTGCTCCTCTGACAAACGAA
TTGCCTGTGAGGAAGAGT-3'

[Top]

RS ID: 1140660 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
1 32797325

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_004964 Link_out NP_004955 Link_out 3 V [Val] / V [Val]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TCAGTCCTTCCAATATGACTAACCAGAACACGAATGAGTACCTGGAGAAGATCAAACAGCGACTGTTTGAGAACCTTAGAATGCTGC
CGCGCACCGCGGT C/T CAAATGCAGGCGATTCCTGAGGACGCCATCCCTGAGGAGAGTGGCGATGAGGACGAAGACGACCCTGACAGG
CGCATCTCGATCTGCTCCTCTGACAAAC-3'

[Top]

RS ID: 1140658 Link_out

Alleles: C/G

Validation:

Not Completed

Details:

Chromosome Reference Position
1 32797321

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_004964 Link_out NP_004955 Link_out 2 G [Gly] / A [Ala]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CACATCAGTCCTTCCAATATGACTAACCAGAACACGAATGAGTACCTGGAGAAGATCAAACAGCGACTGTTTGAGAACCTTAGAATG
CTGCCGCGCACCG C/G GGTTCAAATGCAGGCGATTCCTGAGGACGCCATCCCTGAGGAGAGTGGCGATGAGGACGAAGACGACCCTGA
CAGGCGCATCTCGATCTGCTCCTCTGAC-3'