SNPJam Report for GPHN

Showing coding SNPs for GPHN (Gene ID: 10243)

Show all SNPs for this gene at dbSNP

This SNP viewer is in beta and your feedback is appreciated!

This SNPJam view is a snapshot of the information available at dbSNP and HapMap. It has been reformated to include the information most relevant to drug and metabolomics research.

Please note that population frequency data is updated on a nightly basis and may not be present if this gene was recently annotated.

Show all non-coding SNPs

[Top]

RS ID: 41285476 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
14 67610127

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_020806 Link_out NP_065857 Link_out 3 D [Asp] / D [Asp]
coding-synonymous NM_001024218 Link_out NP_001019389 Link_out 3 D [Asp] / D [Asp]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-ATTCCTAGGACATCTGACTTTAGTACTAAAACAGGAATATTCCTAGGCAAACCAGGATAGTTAGACATCCTCCAACATCTCATTGTC
TCCTTTCATTATAGTGGCTTGTTAGAATAAAAAGCCCTGTGAAATCGCCAGTAGCCACTACTTCAGCATGTACAAGGTCCTTTCTCCATA
ATAAGACTTAATGCTCCTGTTAGGCAGAGACCCTTTTGATTCCCACTTCATACAGAATATAGTGCTGTACTCATGTTAATGCCTATTAGT
GAATAAGGCGATGTAGTTTTAAGTTGGCACTATATCTAAAATCTTTTCCTTGTGTGTTAATTTCTTTGTCTTTATTTTTTTCCAGCCCAG
ATGACTTACTCAATGCCTTGAATGAGGGTATCAGTCGTGCTGA C/T GTCATCATCACATCAGGGGGTGTATCCATGGGGGAAAAGGTA
TGAAAGATAGGGCTCGTGAAAATGTATCTGCTGTAATGTTCTTGCATATGGTCGATTAACTGTGGTCTGGTAGGCATCTGATATTCATAA
CGAGGCTCCCACAAAGCTGAAAATCCATGGGGCTTCAGAAATTACTGGTCTCTTTAAAAGGGATACAATGTGGGTAGGTCAGGGAGCTTA
CCCTCAGGAGCAACCTGGAGAATCCCACAACTTACAGAATGGTTTTTGCTATTCCTGTGGAAACTTCTGACCTGTTTCTCACTCTATTTT
ACTACATTAGGACATCCTTTATGCATGATATTTACCACCAGGGTAAAACTCTAAGATCCTTCCTTCTACTCAAATTTAAACATGACTC-3
'

[Top]

RS ID: 41285470 Link_out

Alleles: A/G

Validation:

  • By cluster

Details:

Chromosome Reference Position
14 67390981

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
intron NM_001024218 Link_out Not Applicable Not Applicable Not Applicable
missense NM_020806 Link_out NP_065857 Link_out 2 N [Asn] / S [Ser]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AGTGAGTGCTTACTAAAGGCTAGTAAGTATTTAAGTTTTGTGTGATTTTTTTTTTATGAAACCAATTGGTGAAACAGGCATTTTTAA
ATCATTATATGTTCCTTTTCCTTTACTCTGAATTAAAAGAGTAAGAAGTGCCATAAATTTCAATCTTAGGAGAGAAGCTTATGGCATTTA
AAATCTAAGCTGATTCTGTCATTCTACATTTGGAAAATGTTAGCATTTCATTTTTCCATTTGTTTTTACCTTTTTTCCTTTTTAGTCATT
TTGCTTGTATAGTTTCATGTTTTCCTGTCACTATATTCATAGTTGTTATGTGTTGTGCATTAGAAGCATCCATTCTACACCAGTCCTGCT
GTTGTCATGGCACACGGTGAACAGCCCATCCCTGGTCTCATCA A/G TTATTCCCATCATTCAACAGATGAACGGGTAAGACAAGAGGC
TTTTGCATTAATGGTTTTCCAAATATGTATTCTACTTCCTCTCCTTGGAGATAGGCTGTAACATATGGAAGATGTGTTGTTTTATTCTGA
TGGATTTTCAGCCTTGCTTTCTTGTGAAAGTGTGAGTGCCATTGAGTATATCCATCAAGGAATTTAATAGAGTTTCTCCTGTGACTAAAG
TACTCTGCTATCATTAAGATTCTGTCATTTGTGACAATGAACTTTTATCAAATGACTTGCAAGAAAGTCATTGCTCAGAAGTTATTTTTG
TCTTACCAATTTCATCAGATATCTTTAAATAAATTGCCTGGCTTAAAATTACCTCTTAAGAGAATCACTTTGAGTCTTAAAATCTAGA-3
'

[Top]

RS ID: 35843923 Link_out

Alleles: -/T

Validation:

Not Completed

Details:

Chromosome Reference Position
14 67346748

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
frameshift NM_020806 Link_out NP_065857 Link_out 2 S [Ser] / F [Phe]
frameshift NM_001024218 Link_out NP_001019389 Link_out 2 S [Ser] / F [Phe]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AATTTTCTTTATTTTCTTGGTCCTCAGCTTTTATTCAGTGGTCCTTGTGAATTGAGTCTGGATGCCTCAAAAAGATAAATGTTTCAG
AAACTAAAAGTATGGTTATTGAAAGCCTGGTTTATAATCATTTTTAAGTGGGTTTTACTAGTCTGACTTCATTCTTTTTTGGCTTATTTC
ACTCAGTCTGCTATTTAATCTTTAATTACAGGCCACAAAAGAAGTAATAGAACGGGAAGCACCAGGGATGGCCCTGGCAATGCTGATGGG
ATCACTTAATGTTACACCTCTGGGCATGCTCTC -/T TAGGTAAGAAAGTCACCAACATGTTGCAAACCATTTGCTAGGTGAACTGTTT
CCGTGATATTAAAAAAAATCTACACTTTGGCATTGTTGTGAATATTAAATGAGCTAGTCCACATAAAGTTCTTAGCTTATACTAATCACT
TAATAAATATTACCTACTATCATTGTTAAAAAAAAAAGTTAATTCCATACCACTAATCAATACACTATATTGATGAACCTAAGAAACTTT
AGTCTTAACACTTAAGTTTGCCCCTTTTTTTTCCAGAGTTAAGAGCTTTAGTATTCTGTCAGCCACAA-3'

[Top]

RS ID: 34844857 Link_out

Alleles: A/C

Validation:

Not Completed

Details:

Chromosome Reference Position
14 67346686

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_020806 Link_out NP_065857 Link_out 3 A [Ala] / A [Ala]
coding-synonymous NM_001024218 Link_out NP_001019389 Link_out 3 A [Ala] / A [Ala]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GAGATGAGATTTCTATCAAATACTTCTGAGCTATAAGCAATATGAAAGGACTGCTAATATAAAAATTTTCTTTATTTTCTTGGTCCT
CAGCTTTTATTCAGTGGTCCTTGTGAATTGAGTCTGGATGCCTCAAAAAGATAAATGTTTCAGAAACTAAAAGTATGGTTATTGAAAGCC
TGGTTTATAATCATTTTTAAGTGGGTTTTACTAGTCTGACTTCATTCTTTTTTGGCTTATTTCACTCAGTCTGCTATTTAATCTTTAATT
ACAGGCCACAAAAGAAGTAATAGAACGGGAAGC A/C CCAGGGATGGCCCTGGCAATGCTGATGGGATCACTTAATGTTACACCTCTGG
GCATGCTCTCTAGGTAAGAAAGTCACCAACATGTTGCAAACCATTTGCTAGGTGAACTGTTTCCGTGATATTAAAAAAAATCTACACTTT
GGCATTGTTGTGAATATTAAATGAGCTAGTCCACATAAAGTTCTTAGCTTATACTAATCACTTAATAAATATTACCTACTATCATTGTTA
AAAAAAAAAGTTAATTCCATACCACTAATCAATACACTATATTGATGAACCTAAGAAACTTTAGTCTT-3'

[Top]

RS ID: 11544391 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
14 67647630

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_020806 Link_out NP_065857 Link_out 3 D [Asp] / D [Asp]
coding-synonymous NM_001024218 Link_out NP_001019389 Link_out 3 D [Asp] / D [Asp]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CCTCCAAAGACAGAACAGTACGTGGAGCTCCACAAAGGCGAGGTGGTGGA C/T GTCATGGTCATTGGACGGCTATGATGGTCACC
AGCAGGAGAAAGCTTTGA-3'