SNPJam Report for GCH1

Showing coding SNPs for GCH1 (Gene ID: 2643)

Show all SNPs for this gene at dbSNP

This SNP viewer is in beta and your feedback is appreciated!

This SNPJam view is a snapshot of the information available at dbSNP and HapMap. It has been reformated to include the information most relevant to drug and metabolomics research.

Please note that population frequency data is updated on a nightly basis and may not be present if this gene was recently annotated.

Show all non-coding SNPs

[Top]

RS ID: 61762303 Link_out

Alleles: -/T

Validation:

Not Completed

Details:

Chromosome Reference Position
14 55369149

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
frameshift NM_001024070 Link_out NP_001019241 Link_out 2 Not Applicable
frameshift NM_001024071 Link_out NP_001019242 Link_out 2 Not Applicable
frameshift NM_000161 Link_out NP_000152 Link_out 2 Not Applicable
frameshift NM_001024024 Link_out NP_001019195 Link_out 2 Not Applicable
utr-5 XM_002343303 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AGGTGCAGCAATGGGTTCCCCGAGCGGGATCCGCCGCGGCCCGGGCCCAGCAGGCCGGCGGAGAAGCCCCCGCGGCCCGAGGCCAAG
AGCGCGCAGCCCGCGGACGGCTGGAAGGGCGAGCGGCCCCGCAGCGAGGAGGATAACGAGCTGAACCTCCCTAACCTGGCAGCCGCCTAC
TCGTCCA -/T CCTGAGCTCGCTGGGCGAGAACCCCCAGCGGCAAGGGCTGCTCAAGACGCCCTGGAGGGCGGCCTCGGCCATGCAGTT
CTTCACCAAGGGCTACCAGGAGACCATCTCAGGTCAGTGCGCCCGCGGGCTGCTAGAGCGTGCGGGCGGCGGGGGCGGTGCTTGCAGGAA
ACGCGCGCCGGCTCCAGGAAGTTTCCGGAGTTGCCTCAC-3'

[Top]

RS ID: 56127440 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
14 55369176

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_001024070 Link_out NP_001019241 Link_out 2 P [Pro] / L [Leu]
missense NM_001024071 Link_out NP_001019242 Link_out 2 P [Pro] / L [Leu]
missense NM_000161 Link_out NP_000152 Link_out 2 P [Pro] / L [Leu]
missense NM_001024024 Link_out NP_001019195 Link_out 2 P [Pro] / L [Leu]
utr-5 XM_002343303 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TAGCCCTTGGTGAAGAACTGCATGGCCGAGGCCGCCCTCCAGGGCGTCTTGAGCAGCCCTTGCCGCTGGGGGTTCTCGCCCAGCGAG
CTCAGGATGGACGAGTAGGCGGCTGCCAGGTTA A/G GGAGGTTCAGCTCGTTATCCTCCTCGCTGCGGGGCCGCTCGCCCTTCCAGCC
GTCCGCGGGCTGCGCGCTCTTGGCCTCGGGCCGCGGGGGCTTCTCCGCCGGCCTGCTGGGCCCGGGCC-3'

[Top]

RS ID: 56041723 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
14 55369674

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense XM_002343303 Link_out XP_002343344 Link_out 2 P [Pro] / L [Leu]
near-gene-5 NM_001024070 Link_out Not Applicable Not Applicable Not Applicable
near-gene-5 NM_001024071 Link_out Not Applicable Not Applicable Not Applicable
near-gene-5 NM_000161 Link_out Not Applicable Not Applicable Not Applicable
near-gene-5 NM_001024024 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GGCCGCGCCTCCTTTTTATGGCCCGGCGGCTCAGCCTGCGCCGCGGAGCGCTCCCATTGGCCGGCCCCGCCTCGCGTCACGGCCCTC
GCCGCGCCCCTCGGCCTCCCGCCCCCGGGGTCC C/T CAGCAGGGGTCGCGGCTCCGGAGACGCCCGGAGGGGTTCGCAAGCGCAGGGA
GGGAAGGAAAAGGGCGCCGGCCCCTAGGATCAGGCGGGACCCCTCCACTTATTGCGGAATGAGCCGAA-3'

[Top]

RS ID: 41298442 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
14 55310817

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
intron NM_001024070 Link_out Not Applicable Not Applicable Not Applicable
intron NM_001024071 Link_out Not Applicable Not Applicable Not Applicable
missense NM_000161 Link_out NP_000152 Link_out 2 K [Lys] / R [Arg]
missense NM_001024024 Link_out NP_001019195 Link_out 2 K [Lys] / R [Arg]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AGCTGAGATTTAATCTTTAGGCCTGCTTTTAAAAACCAAACCAGCAGCTGTCTACTCCTTTAAACAACCTGTGTTGCCTTATTTTGT
AGACACATGTGTATGGTAATGCGAGGTGTACAGAAAATGAACAGCA A/G AACTGTGACCAGCACAATGTTGGGTGTGTTCCGGGAGGA
TCCAAAGACTCGGGAAGAGTTCCTGACTCTCATTAGGAGCTGAGCTTCATTCAGTGTGTGTGCGTTGGTTGCCGATCGTACTGCCAGTAG
CAT-3'

[Top]

RS ID: 41298440 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
14 55310842

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
intron NM_001024070 Link_out Not Applicable Not Applicable Not Applicable
intron NM_001024071 Link_out Not Applicable Not Applicable Not Applicable
nonsense NM_000161 Link_out NP_000152 Link_out 1 R [Arg] / X
nonsense NM_001024024 Link_out NP_001019195 Link_out 1 R [Arg] / X

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-ATATTTCGATATACTTGGTAACTGTGAGCTGAGATTTAATCTTTAGGCCTGCTTTTAAAAACCAAACCAGCAGCTGTCTACTCCTTT
AAACAACCTGTGTTGCCTTATTTTGTAGACACATGTGTATGGTAATG C/T GAGGTGTACAGAAAATGAACAGCAAAACTGTGACCAGC
ACAATGTTGGGTGTGTTCCGGGAGGATCCAAAGACTCGGGAAGAGTTCCTGACTCTCATTAGGAGCTGAGCTTCATTCAGTGTGTGTGCG
TTG-3'

[Top]

RS ID: 41298432 Link_out

Alleles: C/T

Validation:

  • By cluster

Details:

Chromosome Reference Position
14 55369314

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_001024070 Link_out NP_001019241 Link_out 2 P [Pro] / L [Leu]
missense NM_001024071 Link_out NP_001019242 Link_out 2 P [Pro] / L [Leu]
missense NM_000161 Link_out NP_000152 Link_out 2 P [Pro] / L [Leu]
missense NM_001024024 Link_out NP_001019195 Link_out 2 P [Pro] / L [Leu]
utr-5 XM_002343303 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AGTTTAGCCGCAGACCTCGAAGCGCCCCGGGGTCCTTCCCGAACGGCAGCGGCTGCGGCGGGTCCATGGAGAAGGGCCCTGTGCGGG
CACCGGCGGAGAAGCCGCGGGGCGCCAGGTGCAGCAATGGGTTCC C/T CGAGCGGGATCCGCCGCGGCCCGGGCCCAGCAGGCCGGCG
GAGAAGCCCCCGCGGCCCGAGGCCAAGAGCGCGCAGCCCGCGGACGGCTGGAAGGGCGAGCGGCCCCGCAGCGAGGAGGATAACGAGCTG
AACCTCCC-3'

[Top]

RS ID: 1753589 Link_out

Alleles: C/T

Validation:

  • By cluster

Details:

Chromosome Reference Position
14 55369502

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense XM_002343303 Link_out XP_002343344 Link_out 1 N [Asn] / D [Asp]
utr-5 NM_001024070 Link_out Not Applicable Not Applicable Not Applicable
utr-5 NM_001024071 Link_out Not Applicable Not Applicable Not Applicable
utr-5 NM_000161 Link_out Not Applicable Not Applicable Not Applicable
utr-5 NM_001024024 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TAGGGGCCGGCGCCCTTTTCCTTCCCTCCCTGCGCTTGCGAACCCCTCCGGGCGTCTCCGGAGCCGCGACCCCTGCTGGGGACCCCG
GGGGCGGGAGGCCGAGGGGCGCGGCGAGGGCCGTGACGCGAGGCGGGGCCGGCCAATGGGAGCGCTCCGCGGCGCAGGCTGAGCCGCCGG
GCCATAAAAAGGAGGCGCGGCCGGGCTTTCCAGCCTGTGGCCGCTCCCGGCTCGGAGTGTGATCTAAGCAGGT C/T GCGTACCTTCCT
CAGGTGACTCCGGCCACAGCCCATTGTCCGCGGCCACCGGCGGAGTTTAGCCGCAGACCTCGAAGCGCCCCGGGGTCCTTCCCGAACGGC
AGCGGCTGCGGCGGGTCCATGGAGAAGGGCCCTGTGCGGGCACCGGCGGAGAAGCCGCGGGGCGCCAGGTGCAGCAATGGGTTCCCCGAG
CGGGATCCGCCGCGGCCCGGGCCCAGCAGGCCGGCGGAGAAGCCCCCGCGGCCCGAGG-3'