SNPJam Report for GADL1

Showing coding SNPs for GADL1 (Gene ID: 339896)

Show all SNPs for this gene at dbSNP

This SNP viewer is in beta and your feedback is appreciated!

This SNPJam view is a snapshot of the information available at dbSNP and HapMap. It has been reformated to include the information most relevant to drug and metabolomics research.

Please note that population frequency data is updated on a nightly basis and may not be present if this gene was recently annotated.

Show all non-coding SNPs

[Top]

RS ID: 115154257 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
3 30880518

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_207359 Link_out NP_997242 Link_out 1 E [Glu] / K [Lys]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AATCTTCTCATTTATACTTTACAAGAAAGTGGCATACTTATTTCCCCCAATTTGAGACACAAACAAAAGCGTTGGGGACTCCACATC
TAGTTTCTGAGAATAAGAAAAATTTCTACCAAGGCTACAAAAAGACCAAAGGTTAAACAGGTATGTACACATAAATGAACTTACATCTAC
ATGAAGCCAGAGGCTGTGCCTCT C/T GCAGATGTCTGCTATTTCATCCAGAGGGTCAAAAGCTCCCAACACAGTTGTACCAGAAGTGG
CACAGACAAGAAACGGTGCTGCCCCCTGTAAGAAGGATCCACACACACAAAATTATCACTGTCATCACTAAATTTGTCCTGTAATAGCTG
GAAAATATAAAGGGTTATGCATCCAGAGAGTTATTTGGGTTTTTTGGA-3'

[Top]

RS ID: 113544298 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
3 30880564

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_207359 Link_out NP_997242 Link_out 3 T [Thr] / T [Thr]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CCAATTTGAGACACAAACAAAAGCGTTGGGGACTCCACATCTAGTTTCTGAGAATAAGAAAAATTTCTACCAAGGCTACAAAAAGAC
CAAAGGTTAAACAGGTATGTACACATAAATGAACTTACATCTACATGAAGCCAGAGGCTGTGCCTCTCGCAGATGTCTGCTATTTCATCC
AGAGGGTCAAAAGCTCCCAACAC A/G GTTGTACCAGAAGTGGCACAGACAAGAAACGGTGCTGCCCCCTGTAAGAAGGATCCACACAC
ACAAAATTATCACTGTCATCACTAAATTTGTCCTGTAATAGCTGGAAAATATAAAGGGTTATGCATCCAGAGAGTTATTTGGGTTTTTTG
GAGGTAGTCATTAATTCAATGGGTGTTTTTAAATTTTGTGAATATGTG-3'

[Top]

RS ID: 112071781 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
3 30875378

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_207359 Link_out NP_997242 Link_out 3 I [Ile] / I [Ile]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TTATCTAGGCTTATTTGTCTTTCATGTAGAGACCATCAACACATTTCCCAAACACCTTCAATTTACGCCTCGCCCAAGTCACCAAGA
GATGAGCAAAAATGAAGCCCTTGGCAAGCACAGTGGCTTAACCCCCTTGAAGCCCAAAGGACCACAAGAGGAAAACTTACAGATTTGTCT
TTCACAAGGAGAGCACAGCACTG A/G ATCCCAGCCATCAGCATCTTGTGTGGGTTCCAGGCCACAGAGTCAGCCCTATTGTTTAAACA
AAGGGACAGAGTAGGGAGAGGACTCAATTAGTTTCTACAGGCAATGGAATACTATCATTATCAATATCTGCATTCAGTACTCATACATAG
TTTACTGTTCTATAGAACTCCTTATCTGAGTGGTTTAAGGAATTTGGA-3'

[Top]

RS ID: 111590277 Link_out

Alleles: C/G

Validation:

Not Completed

Details:

Chromosome Reference Position
3 30769832

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_207359 Link_out NP_997242 Link_out 1 V [Val] / L [Leu]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TTTCTCATCAGAAGGGCTGCAATCTACTGTGTATCTCCAAGATGTTCTGGATCTAAACTCTCCCAGGATAGGATCTATGCCTCTGGG
GGACCAAAGCCACAGCTACATGTCTTTACCCAGTAAGTCTATCTCATCCAGGAGGAAGTCCATGTCCTCCCGGCTCACTTGAGGGCTGAT
CACCACCTGGCGGAAGAAGTTGA C/G CTTTCCCCGGTGCGGCTGGTAGCCCAGCATCAAGCTTCCCTTCTTCATCATCCTCTCCTTAA
TGGCTGGGGCCACCTGTGTGGGGAGAAAAGGGGAGAGGGGTGAAAGACCAGAACATCAAGGCATTTCAATAGCATTTTCACCAGCCATTG
GACATTTACTGGGCATCCACTGGTTTGGATCCCATTCTCATTCACACA-3'

[Top]

RS ID: 79295641 Link_out

Alleles: C/T

Validation:

  • By cluster

Details:

Chromosome Reference Position
3 30842510

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_207359 Link_out NP_997242 Link_out 2 S [Ser] / N [Asn]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CACACACACACACACACACACACACACACACACAGAAAGAGAGAGAGAGAGAGAGAGAGAGAGGCTAGTACCTAGATAAAGCAAGAG
CACGATTAACTCTTTCTTCAAGGCCTAATGTACCCAGGGCCTTCCAGGTCATCCAGAACTTGAATGCATCTGGTCTTCTGCTACACTGGA
TAGACTTGTCTCCTGTGTCATAG C/T TCACATCATAGAATTTATCCTGCTGGAAGAGGTAAGATGCCTTGGCAGAGTAGCATTTTTTA
AGAAGATCCTTCGAAAAAGAAAAGATTACAAGACTGTTAAACTTTAGAATATAACTTGATTTTGAAAGCAAACACATGTACACACACAAT
GTGTATATTCTACCTGTGCCAAGTGTACATCTCACTTTGACTGCCTTA-3'

[Top]

RS ID: 73061102 Link_out

Alleles: C/G

Validation:

  • By cluster

Details:

Chromosome Reference Position
3 30842558

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_207359 Link_out NP_997242 Link_out 2 S [Ser] / C [Cys]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GAGAGAGAGAGAGAGGCTAGTACCTAGATAAAGCAAGAGCACGATTAACTCTTTCTTCAAGGCCTAATGTACCCAGGGCCTTCCAGG
TCATCCAGAACTTGAATGCATCTGGTCTTCTGCTACACTGGATAGACTTGTCTCCTGTGTCATAGCTCACATCATAGAATTTATCCTGCT
GGAAGAGGTAAGATGCCTTGGCA C/G AGTAGCATTTTTTAAGAAGATCCTTCGAAAAAGAAAAGATTACAAGACTGTTAAACTTTAGA
ATATAACTTGATTTTGAAAGCAAACACATGTACACACACAATGTGTATATTCTACCTGTGCCAAGTGTACATCTCACTTTGACTGCCTTA
CATCAGACACAATCAGTGTACATTGACTTTCAGATACACATTACCCAT-3'

[Top]

RS ID: 62636628 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
3 30769819

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_207359 Link_out NP_997242 Link_out 2 R [Arg] / L [Leu]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GGAGGAAGTCCATGTCCTCCCGGCTCACTTGAGGGCTGATCACCACCTGG C/T GGAAGAAGTTGACCTTTCCCCGGTGCGGCTGG
TAGCCCAGCATCAAGCTT-3'

[Top]

RS ID: 62636627 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
3 30769840

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_207359 Link_out NP_997242 Link_out 2 R [Arg] / L [Leu]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GGCTCACTTGAGGGCTGATCACCACCTGGCGGAAGAAGTTGACCTTTCCC C/T GGTGCGGCTGGTAGCCCAGCATCAAGCTTCCC
TTCTTCATCATCCTCTCC-3'

[Top]

RS ID: 61738477 Link_out

Alleles: A/C

Validation:

Not Completed

Details:

Chromosome Reference Position
3 30842517

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_207359 Link_out NP_997242 Link_out 1 D [Asp] / H [His]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TGGTCTTCTGCTACACTGGATAGACTTGTCTCCTGTGTCATAGCTCACAT A/C ATAGAATTTATCCTGCTGGAAGAGGTAAGATG
CCTTGGCAGAGTAGCATT-3'

[Top]

RS ID: 34145542 Link_out

Alleles: -/A

Validation:

Not Completed

Details:

Chromosome Reference Position
3 30903109

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
frameshift NM_207359 Link_out NP_997242 Link_out 2 L [Leu] / F [Phe]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CATCCCTGTGCTTCATGTCCTTATGTGATTAAGCTCTAGGGTCTCAGCCAATCTTCCCACGAATGATGACTGGCAGAGTAAGGAGGC
AACCCTTCAAGGACAGCAGGAATTGCCTGAAGGACAGCCTACACTTTTATATCTGGACATCCTTTTGAGACAAAGGCATAGAAGAAATAA
AAACTTGGCCTTCCCATTTGCTTTCTATTCAGCCATACTGATTTGGGGAACATCTATCTTTCCCATTTCTGCAATTTCTTACAGGTTTTA
ATTTTTACCTTCTCATTGACATCTGTAGCTTTC -/A AAAACCACCTCTTCCATTATTAGCCTACAGGCCTCTTCAACAAATTTTTCTC
CAGCTTTTGCATCTGTTGTAGGACCATTCAGCACAACCCCATCCACAAGAACAGCATTCTTCTTACTTGGAATCATCTCTTGTTGATCAA
TATCTCCTGGAAGCAAGCAAACAAATTGTGTTTGAGAGATAATCTAATTACACCACATAACAAAGCACGGGACAAAATGCATCACTATCC
CAGCTTCAGATGGCACATCTTTTAATACATGAAGGCATCATTTGAGGTGTTGAGCTGACAATTTCTTA-3'

[Top]

RS ID: 10622055 Link_out

Alleles: -/CT

Validation:

Not Completed

Details:

Chromosome Reference Position
3 30819744

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_207359 Link_out NP_997242 Link_out 1 I [Ile] / R [Arg]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AGTAGCAGAGTTGAAATAAATAGTCATTCATCACACAACTTTAACCTTGTGTCCCATGACCAGATGTCACTTCCTGAAGTACACTGT
GAGCCAGAACTTCTACCTTACAGACAACCTAATTGTTTTGGGTGTGTGTCAACCATGTTAATTTGTTAAATGTAAACAATGTCTACAACT
GTTTGGCCTGTCATTACTTTTTAACAAACTAGAAGACACTTCTCTAGATAATTCTGTGCTTGCTAGGCCCTCTTATTTATAGGATCAACA
GATAATGTACACTGAATCTACTTCATCAAAAAGAAAAATACCATTTACTTATTACTTACCAAATTAAGTTTTGCCCAGAACTCGGGTCCT
TCTTCCATCTCTCTGAGGCTCGGTGGAATGTACCAAAAGCAAA -/CT TATTGGCATATTCAGGCTGAGAATTAGAAAAAATATAAAGT
TGTTATCTTAAGATTTATCTTAGAATGCAATGAAATACTTTTAAAACTCTTAGCTAGTTTCTTCAAGAGTTATCATGTGTATAAAATTTT
AACATCAGAATCTTATAGAGTAACAATCCCTTCTGCCTTCTTGATAACATCCTATTTAAAAATTTTCTACTCCATAGCGTGCACCTAGCA
GGTTCTCTTTCATCTTAAATGTGCAAAGATCAGGAAAAAACAGTAAAGTTTGAAGCTGACTCAACCCAGCTCTGATCGTCAGTTAGTGCC
TGCTTACATACATGCTCAGAGATGCCCTGGATCCTCTCTCTCCAACACTGATCCTTAAGTTATTTGCTATACCATCATAGGCTTCCAAT-
3'

[Top]

RS ID: 5847631 Link_out

Alleles: -/G

Validation:

Not Completed

Details:

Chromosome Reference Position
3 30769836

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
frameshift NM_207359 Link_out NP_997242 Link_out 2 G [Gly] / G [Gly]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-ACTTAAGAGTATGGGCTTAGGGAGAAAATGCCTGGGACCTTGAGATACTGATTTACTCGCCATGTACCTGTTTTCTCGACCATAAAT
GGGCACATTAGTAGCATCTTCCTCACTGTTATTGTGAAGATTAATTAATATGTCTAAAGCACTTGAATCAGTACTCATGAGTCCTCCATA
AATTATTATTATTATTAGTGTCAACCTTGTGTGAATGAGAATGGGATCCAAACCAGTGGATGCCCAGTAAATGTCCAATGGCTGGTGAAA
ATGCTATTGAAATGCCTTGATGTTCTGGTCTTTCACCCCTCTCCCCTTTTCTCCCCACACAGGTGGCCCCAGCCATTAAGGAGAGGATGA
TGAAGAAGGGAAGCTTGATGCTGGGCTACCAGCCGCACCGGGG -/G AAAGGTCAACTTCTTCCGCCAGGTGGTGATCAGCCCTCAAGT
GAGCCGGGAGGACATGGACTTCCTCCTGGATGAGATAGACTTACTGGGTAAAGACATGTAGCTGTGGCTTTGGTCCCCCAGAGGCATAGA
TCCTATCCTGGGAGAGTTTAGATCCAGAACATCTTGGAGATACACAGTAGATTGCAGCCCTTCTGATGAGAAATAGGGAATACTCCCAGT
CCAGGCCCAGCAAAACCAAAATGCTAAGCAATGAATATTAAGGACTCTCTAGCTGCCTGGGCATTACTGTTGCTAAAAGAAGAAAGTTTA
AAAAAAAAAATGATTTTCTCAAGGAATGCCCCTGGAACACAGCTCTGAAGAGAGTTTAGTAAGTACCATGTAGGTTCTGGATTCTAAG-3
'

[Top]

RS ID: 1393746 Link_out

Alleles: C/G

Validation:

  • By hap map

Details:

Chromosome Reference Position
3 30903223

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_207359 Link_out NP_997242 Link_out 3 K [Lys] / N [Asn]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TGACTAACTCAGCCCAGTACAGAGTGACATATATAATAAGGTAGATTTACTTAATCCATAAATTGTGAGCTTTCTTTGTAAAATTTT
CCTTAACTATCATACCATGGTGTGTCATAAGAAATTGTCAGCTCAACACCTCAAATGATGCCTTCATGTATTAAAAGATGTGCCATCTGA
AGCTGGGATAGTGATGCATTTTGTCCCGTGCTTTGTTATGTGGTGTAATTAGATTATCTCTCAAACACAATTTGTTTGCTTGCTTCCAGG
AGATATTGATCAACAAGAGATGATTCCAAGTAA C/G AAGAATGCTGTTCTTGTGGATGGGGTTGTGCTGAATGGTCCTACAACAGATG
CAAAAGCTGGAGAAAAATTTGTTGAAGAGGCCTGTAGGCTAATAATGGAAGAGGTGGTTTTGAAAGCTACAGATGTCAATGAGAAGGTAA
AAATTAAAACCTGTAAGAAATTGCAGAAATGGGAAAGATAGATGTTCCCCAAATCAGTATGGCTGAATAGAAAGCAAATGGGAAGGCCAA
GTTTTTATTTCTTCTATGCCTTTGTCTCAAAAGGATGTCCAGATATAAAAGTGTAGGCTGTCCTTCAG-3'