SNPJam Report for EPN1

Showing coding SNPs for EPN1 (Gene ID: 29924)

Show all SNPs for this gene at dbSNP

This SNP viewer is in beta and your feedback is appreciated!

This SNPJam view is a snapshot of the information available at dbSNP and HapMap. It has been reformated to include the information most relevant to drug and metabolomics research.

Please note that population frequency data is updated on a nightly basis and may not be present if this gene was recently annotated.

Show all non-coding SNPs

[Top]

RS ID: 77635294 Link_out

Alleles: A/C

Validation:

Not Completed

Details:

Chromosome Reference Position
19 56188968

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
intron NM_013333 Link_out Not Applicable Not Applicable Not Applicable
intron NM_001130072 Link_out Not Applicable Not Applicable Not Applicable
missense NM_001130071 Link_out NP_001123543 Link_out 1 S [Ser] / R [Arg]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TCTCTTGTTTCTCGTCACCAGTCTCGGGATGGGTTAATTTAATTTAGGTTAATTTAAAAGTATGAGTTTTGGAGTTCAGGTGGGCCT
CGGGTTGAGTCTGCCCTGCCATTCCTGGTGTGTGACCTTGGTTGAATTATTTAACTTCCAGGAGCCCAGTCTTTGCATGCAGTGTTGAAA
AAGGTAATGTCCCTCTTGTGCTG A/C GCGAGCACCTGGCACACAGCAGGGACCCAGGCAGTGGGGCTGTTAGGTTCCTTATCTCTCCT
GAGCCTTGGGCTTCCGCTATCCTTGGGACGTCTGGTCTTCTGGCTTCCCCGGTTCTTCCTGCCGCCCTGGGTTGGTTCCCTGCTCCTGCC
TCTGTCTTTAATCCCTTCATCAGCCTTCTTTCCCATGTGTCCTTGTTT-3'

[Top]

RS ID: 75693236 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
19 56196875

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_013333 Link_out NP_037465 Link_out 3 R [Arg] / R [Arg]
coding-synonymous NM_001130071 Link_out NP_001123543 Link_out 3 R [Arg] / R [Arg]
coding-synonymous NM_001130072 Link_out NP_001123544 Link_out 3 R [Arg] / R [Arg]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CGGCCGCCCCAGAGCCCGCGTCGCAGGCAGTCTCTGGCCCGCCTTGTGCCCGGCGTGCTGACCGGGCATCCCCGTGCCCGCTCGCAG
GCCATGACGCTGATGGAGTACCTCATCAAGACCGGCTCGGAGCGCGTGTCGCAGCAGTGCAAGGAGAACATGTACGCCGTGCAGACGCTG
AAGGACTTCCAGTACGTGGACCG C/T GACGGCAAGGACCAGGGCGTGAACGTGCGTGAGAAAGCTAAGCAGCTGGTGGCCCTGCTGCG
CGACGAGGACCGGCTGCGGGAAGAGCGGGCGCACGCGCTCAAGACCAAGGAAAAGCTGGCACAGACCGCCACGGGTGAGTCCCTCCCTGC
GGCCCCTGACGGCCTAGAGTCTGTCCTCCGCCTACTGCGGCTCCCGGC-3'

[Top]

RS ID: 75064566 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
19 56189025

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
intron NM_013333 Link_out Not Applicable Not Applicable Not Applicable
intron NM_001130072 Link_out Not Applicable Not Applicable Not Applicable
missense NM_001130071 Link_out NP_001123543 Link_out 1 S [Ser] / P [Pro]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AAGTATGAGTTTTGGAGTTCAGGTGGGCCTCGGGTTGAGTCTGCCCTGCCATTCCTGGTGTGTGACCTTGGTTGAATTATTTAACTT
CCAGGAGCCCAGTCTTTGCATGCAGTGTTGAAAAAGGTAATGTCCCTCTTGTGCTGAGCGAGCACCTGGCACACAGCAGGGACCCAGGCA
GTGGGGCTGTTAGGTTCCTTATC C/T CTCCTGAGCCTTGGGCTTCCGCTATCCTTGGGACGTCTGGTCTTCTGGCTTCCCCGGTTCTT
CCTGCCGCCCTGGGTTGGTTCCCTGCTCCTGCCTCTGTCTTTAATCCCTTCATCAGCCTTCTTTCCCATGTGTCCTTGTTTCTGCTGTGG
ATTCCTGCCCCCTCTGCCCTTGTTCCAGAGGTCTTTCCTGCCCTCCCT-3'

[Top]

RS ID: 74369843 Link_out

Alleles: C/G

Validation:

  • By frequency

Details:

Chromosome Reference Position
19 56188985

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
intron NM_013333 Link_out Not Applicable Not Applicable Not Applicable
intron NM_001130072 Link_out Not Applicable Not Applicable Not Applicable
missense NM_001130071 Link_out NP_001123543 Link_out 3 H [His] / Q [Gln]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CCAGTCTCGGGATGGGTTAATTTAATTTAGGTTAATTTAAAAGTATGAGTTTTGGAGTTCAGGTGGGCCTCGGGTTGAGTCTGCCCT
GCCATTCCTGGTGTGTGACCTTGGTTGAATTATTTAACTTCCAGGAGCCCAGTCTTTGCATGCAGTGTTGAAAAAGGTAATGTCCCTCTT
GTGCTGAGCGAGCACCTGGCACA C/G AGCAGGGACCCAGGCAGTGGGGCTGTTAGGTTCCTTATCTCTCCTGAGCCTTGGGCTTCCGC
TATCCTTGGGACGTCTGGTCTTCTGGCTTCCCCGGTTCTTCCTGCCGCCCTGGGTTGGTTCCCTGCTCCTGCCTCTGTCTTTAATCCCTT
CATCAGCCTTCTTTCCCATGTGTCCTTGTTTCTGCTGTGGATTCCTGC-3'

[Top]

RS ID: 61736526 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
19 56200285

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_013333 Link_out NP_037465 Link_out 3 A [Ala] / A [Ala]
coding-synonymous NM_001130071 Link_out NP_001123543 Link_out 3 A [Ala] / A [Ala]
coding-synonymous NM_001130072 Link_out NP_001123544 Link_out 3 A [Ala] / A [Ala]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GCCTCATCAGCAGCTGTGGGCTCAGGCCCCCCTCCCGAGGCGGAGCAGGC A/G TGGCCGCAGAGCAGCGGGGAGGAGGAGCTGCA
GCTCCAGCTGGCCCTGGC-3'

[Top]

RS ID: 61736521 Link_out

Alleles: C/T

Validation:

  • By cluster

Details:

Chromosome Reference Position
19 56206311

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_013333 Link_out NP_037465 Link_out 2 P [Pro] / L [Leu]
missense NM_001130071 Link_out NP_001123543 Link_out 2 P [Pro] / L [Leu]
missense NM_001130072 Link_out NP_001123544 Link_out 2 P [Pro] / L [Leu]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AGGAGAGGTGCCGGCCCGAAGCCCTGGGGCGTTTGACATGAGTGGGGTCAGGGGATCTCTGGCTGAGGCTGTGGGCAGCCCCCCACC
TGCAGCCACACCAACTCCCACGCCCCCCACCCGGAAGACGCCGGAGTCATTCCTGGGGCCCAATGCAGCCCTCGTCGACCTGGACTCGCT
GGTGAGCCGGCCGGGCCCCACGC C/T GCCTGGAGCCAAGGCCTCCAACCCCTTCCTGCCAGGCGGTGAGTGTGGGCCCATCACCTGCT
CAAGTCCTTCCTGTGGGTTCCACCAGAGGAGGTGCCTCACGGGGCAGGGACACTTCGCCCTTTGCCTGCACATGCTGGATGGACACAGGT
GGGCTGCGCCACTGACTCCACTCCGTGTCTCTGGTTTACTCTTCCTGC-3'

[Top]

RS ID: 35764106 Link_out

Alleles: -/C

Validation:

Not Completed

Details:

Chromosome Reference Position
19 56190080

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
frameshift NM_013333 Link_out NP_037465 Link_out 3 S [Ser] / S [Ser]
frameshift NM_001130071 Link_out NP_001123543 Link_out 3 S [Ser] / S [Ser]
frameshift NM_001130072 Link_out NP_001123544 Link_out 3 S [Ser] / S [Ser]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TTAACAAGGGACAGAGCCTTCTGGGCCACAGTTAGGAACTCATCTTTGACCCTGAGGGCTCTGGGCAGGCCATGTCCCATTTGTGTT
TCCAGAGGTCCTCTTCCCCTCGCAGATGCGGTGACCTGCCAGCACCTGCCGCAGCCTTCGTCCGGGAGTCGCCCCATCTCTCCACGCATC
GGGGCCCTGTGCCCCTTGCTGCTGCAGCCGGGCACCATGTCGACCTCGTCCTTGAGGCGCCAGATGAAGAACATCGTCCACAACTACTCA
GAGGCGGAGATCAAGGTTCGAGAGGCCACGAGC -/C AATGACCCCTGGGGCCCATCCAGCTCCCTCATGTCAGAGATTGCCGACCTCA
CCTACAACGTTGTCGCCTTCTCGGAGATCATGAGCATGATCTGGAAGCGGCTCAATGACCATGGCAAGAACTGGCGTCACGTTTACAAGG
TCAGCATCCTGCTCTCCTCCCCGGGCAGGTGCAGGGGCTCAGGTGGGAGGACAGGAGCCCGTGTTGTGCACCCTGCCTGGGATGGCATCC
CGGTTCTCAAGAGGAACTGGAGAAGAGTAAAATCTCTCTTTTTGTTTAATGAAGGCAACGAATATAAG-3'

[Top]

RS ID: 34908329 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
19 56206240

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_013333 Link_out NP_037465 Link_out 3 P [Pro] / P [Pro]
coding-synonymous NM_001130071 Link_out NP_001123543 Link_out 3 P [Pro] / P [Pro]
coding-synonymous NM_001130072 Link_out NP_001123544 Link_out 3 P [Pro] / P [Pro]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GCGATGCTTCCGCTCTGCACCTCAGTTCCTCCTTCCCGAGGCCTCTGGGCACCGGGCTCTTTGAAGCGCCCCCTATGATGGCCTATA
CTGCTCCCGGGTTGGAGCCTCACTGCTGTCTGCCCTGTCTGAGCCCCTCTCCCGGATCCTTCCAGGAGAGCTGGAGCTGCTGGCAGGAGA
GGTGCCGGCCCGAAGCCCTGGGGCGTTTGACATGAGTGGGGTCAGGGGATCTCTGGCTGAGGCTGTGGGCAGCCCCCCACCTGCAGCCAC
ACCAACTCCCACGCCCCCCACCCGGAAGACGCC A/G GAGTCATTCCTGGGGCCCAATGCAGCCCTCGTCGACCTGGACTCGCTGGTGA
GCCGGCCGGGCCCCACGCCGCCTGGAGCCAAGGCCTCCAACCCCTTCCTGCCAGGCGGTGAGTGTGGGCCCATCACCTGCTCAAGTCCTT
CCTGTGGGTTCCACCAGAGGAGGTGCCTCACGGGGCAGGGACACTTCGCCCTTTGCCTGCACATGCTGGATGGACACAGGTGGGCTGCGC
CACTGACTCCACTCCGTGTCTCTGGTTTACTCTTCCTGCAGGAGGCCCAGCCACTGGCCCTTCCGTCA-3'

[Top]

RS ID: 11545669 Link_out

Alleles: C/G

Validation:

  • By frequency
  • By cluster

Details:

Chromosome Reference Position
19 56206137

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_013333 Link_out NP_037465 Link_out 2 G [Gly] / A [Ala]
missense NM_001130071 Link_out NP_001123543 Link_out 2 G [Gly] / A [Ala]
missense NM_001130072 Link_out NP_001123544 Link_out 2 G [Gly] / A [Ala]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TCAGAGGGTGACACCTGCTTCTGTCATCCCTCTTGTGTTTGCTCACTGGAATCAGACCCACCTTATGGGAATCTGGGCTGACGTGAG
GTTTTGGCCTGGGCAAGCGATGCTTCCGCTCTGCACCTCAGTTCCTCCTTCCCGAGGCCTCTGGGCACCGGGCTCTTTGAAGCGCCCCCT
ATGATGGCCTATACTGCTCCCGGGTTGGAGCCTCACTGCTGTCTGCCCTGTCTGAGCCCCTCTCCCGGATCCTTCCAGGAGAGCTGGAGC
TGCTGGCAGGAGAGGTGCCGGCCCGAAGCCCTG C/G GGCGTTTGACATGAGTGGGGTCAGGGGATCTCTGGCTGAGGCTGTGGGCAGC
CCCCCACCTGCAGCCACACCAACTCCCACGCCCCCCACCCGGAAGACGCCGGAGTCATTCCTGGGGCCCAATGCAGCCCTCGTCGACCTG
GACTCGCTGGTGAGCCGGCCGGGCCCCACGCCGCCTGGAGCCAAGGCCTCCAACCCCTTCCTGCCAGGCGGTGAGTGTGGGCCCATCACC
TGCTCAAGTCCTTCCTGTGGGTTCCACCAGAGGAGGTGCCTCACGGGGCAGGGACACTTCGCCCTTTG-3'