SNPJam Report for CRYZ

Showing coding SNPs for CRYZ (Gene ID: 1429)

Show all SNPs for this gene at dbSNP

This SNP viewer is in beta and your feedback is appreciated!

This SNPJam view is a snapshot of the information available at dbSNP and HapMap. It has been reformated to include the information most relevant to drug and metabolomics research.

Please note that population frequency data is updated on a nightly basis and may not be present if this gene was recently annotated.

Show all non-coding SNPs

[Top]

RS ID: 7527057 Link_out

Alleles: A/T

Validation:

  • By cluster
  • By frequency
  • By 2 hit 2 allele
  • By hap map

Details:

Chromosome Reference Position
1 75172001

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_001134759 Link_out NP_001128231 Link_out 3 G [Gly] / G [Gly]
coding-synonymous NM_001130042 Link_out NP_001123514 Link_out 3 G [Gly] / G [Gly]
coding-synonymous NM_001130043 Link_out NP_001123515 Link_out 3 G [Gly] / G [Gly]
coding-synonymous NM_001889 Link_out NP_001880 Link_out 3 G [Gly] / G [Gly]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AACCTTTATAAAGGTAAGTAGGCTTGAAAACCCTTGGAAACTGAGCAGTCTTATTTTGAACTAGCATGTTTTAATCAAAGGTATGGA
ATTAATCAAATATCAATTAAGAATTACTGGAATGCACACTCATGCCAAATGACAACTAACATGTTATTTCCTACTATGATGACTCTTTGA
TTTGAGACAGATGGCATAAAAAAATATTGCTAGCTATACAATAAATTTTACTCTTCTGCTTCTGCTCTCTAAAGAAAAATCTTATTTTTT
CACATAAGAAGCTCATGGAATCGAATGTTAATTAAAGAAAAGATAGGGTAAGTACAACTGGGGGAAAGACAGTACCTCTAATTACATAGG
AAATCCATGAAAGAATTAATCATCATAAGAGAAGAATCATTTT A/T CCAGTAGCCCCACTACCATGAATGATATTTTCATGAGCCTCG
GCCACCTTCTCCAATGGATATTGAGAACCTATCACAGGTTTCAACCAGCCAATTTCCATTCCAGCTTGAAGGGCTGCTGCATATTGCTGA
AATTCCTCCTAAGAAAAGGAAAAACAAATTTCTTTTTGTAGTGAACCGTATGATTTAATTTTCAGAAGCATTAAAAACACTTCAGAATCT
AAGTGTTATACCATGAAGAGTCTCTTACAAATGTGTGACTTTTGTCAACTTGTCCAGAACTATAGAAAAAGTAGTTATCTACAGGGTAAC
CATAAATCCCATCTGCCTGAGACAGTGTTAGTGTACAAAATACCTGTTGTCCTGAAATTATTACTAGTATCACATTTCTATCTCAAAA-3
'

[Top]

RS ID: 3819946 Link_out

Alleles: C/T

Validation:

  • By cluster
  • By frequency
  • By 2 hit 2 allele
  • By hap map

Details:

Chromosome Reference Position
1 75175886

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_001134759 Link_out NP_001128231 Link_out 1 I [Ile] / V [Val]
missense NM_001130042 Link_out NP_001123514 Link_out 1 I [Ile] / V [Val]
missense NM_001130043 Link_out NP_001123515 Link_out 1 I [Ile] / V [Val]
missense NM_001889 Link_out NP_001880 Link_out 1 I [Ile] / V [Val]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AGCTGCAGCTTTACTTAGAATGTTATTTGCATTAAAAAATCAATTTTTATAGCTATAAGATTCTAGAGAAGCTATATTCTATTTAAT
ACACATAAACAATACAAAAATGATAGTAAAAGTTTAAAACTTAGACATCTGTTTTTTAAATAAAGTTTTAAAACACGCATAAAAATTCAT
CGCACTGAAAAAAGGAAGCAAACAGCTTTAAAGGAGTAGTTGGTTAAAAACATATTAAAAAACCACGCAAGTCTCCAAGGAACAAAGTTT
GACTTTTGTAAAACAGTGGAAAATTTTACCTTAATTTTATCAATGTAATTCACTTCTCTGTGATTGAACACTTCATGGGCTCCATTTTGC
AAAACAATCTTTTGTCCTTCCTCAGTACCAGCAGTGCCCAAAA C/T CTTTAAGCCATAAGCTCTAGCAATTTGGCATGCTGCTAATCC
AACCTGAAAAACAAATATAACCCAAGAGTTATATATTCTCTACACTCCTGTAAACACTTAAATACATACAATGAACTTAAGATTCCTATA
GGACCCACCCTAACTTTAAGGAACTTAAGAGTGTAAATGAAGAAATAAGAAAAACAGCTAACTTTAATTGAGCATTTAAAATATTCCAGG
AACCATACTAAATAATTTCTACATATTGTTTTATTCTATCCTCACAATGACCCTATAAAGTAGATACTATTATTGTCCCTATTGTACAGA
TAAGAAAGTTGAAGCTTCAAATTATAAGTAATTTGGCCAAGTCATATGCGGAGATGGAAACAGGAGTTAGACCAGTCTGACTGCAGAA-3
'

[Top]

RS ID: 1051122 Link_out

Alleles: A/G

Validation:

  • By frequency
  • By cluster

Details:

Chromosome Reference Position
1 75190452

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_001130042 Link_out NP_001123514 Link_out 3 G [Gly] / G [Gly]
coding-synonymous NM_001130043 Link_out NP_001123515 Link_out 3 G [Gly] / G [Gly]
coding-synonymous NM_001889 Link_out NP_001880 Link_out 3 G [Gly] / G [Gly]
intron NM_001134759 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TGATTCCTTTGTTGAAGGCACTGAATCCCTGCAGGAAGTAGCATGAAGGATTCTGCTTTATAGCTGAGGGATTTGTAAGATGAAAGG
TCCTTAAACATGAAATGAGATCAGTGGTAAGCTCATGATTTAAATTGTTATTTGAAAAAATTGTTTGATCTGCTCCCTCCAGGGGGGAAA
AACATGGTGATATCCTAGATACAATGTGACAATACATTAATTTTTTTTCTTCCTTAGTATCTAGATCACCATGGCGACTGGACAGAAGTT
GATGAGAGCTGTTAGAGTTTTTGAATTTGGTGG A/G CCAGAAGTCCTGAAATTGCGATCAGATATTGCAGTACCGATTCCAAAAGACC
ATCAGGTAGAAATAAAATTACTTTATTGAGGCTATAATTATACTGAGTGTGAGTCTCTTGCACATTGTATTAAAAAGAAGCAGACTCACA
ATTATTTTTAAAAACATTGAATTAGGATGCAGTTTACACTATGTATACATATGGACATTGATAAAGTTAACATAAACCTGATAATTAGTG
AAGTAGATGTATGAAAAAGAATAACCTCTGGTTATAAGAAAATTTTTGATGTAGGGAATGATCTATGT-3'

[Top]

RS ID: 143670067 Link_out

Alleles: A/C

Validation:

  • By frequency
  • By cluster

Details:

Chromosome Reference Position
1 75199023

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_138467 Link_out NP_612476 Link_out 2 E [Glu] / A [Ala]
missense NM_001162916 Link_out NP_001156388 Link_out 2 E [Glu] / A [Ala]
upstream-variant-5KB NM_001134759 Link_out Not Applicable Not Applicable Not Applicable
upstream-variant-5KB NM_001130042 Link_out Not Applicable Not Applicable Not Applicable
upstream-variant-5KB NM_001130043 Link_out Not Applicable Not Applicable Not Applicable
upstream-variant-5KB NM_001889 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CTCTCCACCCCTAGGCGAAGGCACTAGAATTTCCCAAATTAAGAACGAAGAGGAAGTTTGGACCTTTTCGGCCACCGCTCGCTTCAA
TATGGCTGCCCCCAGGGAGAGACGAGGCTACCATGAAGGAGCCGAGCGCAGACCCTGAGTCCGTCACCCATGGATCGCAGCGCGGAGTTC
AGGAAATGGAAGGCGCAATGTTTGAGCAAAGCGGACCTCAGCCGGAAGGGCAGTGTTGACGAGGATGTGGTAG A/C GCTTGTGCAGTT
TCTGAACATGCGAGATCAGTTTTTCACCACCAGCTCCTGCGCTGGCCGCATCCTACTCCTTGACCGGGTGAGGCCCCTTTGCGCCTGTCC
ATCGCCTGCCTTCTAGTGCGAAACTTCAGGAGCCCTGTTCCCATCCAGTGACGACCGGATCCAGCATGTCTGTGTTTGCTCCTCTGAGGG
GTGGTCTCTGTTTCTTTATATGTGAAATTTAGGGGATTAGATCAGTGCTTCTAAAAGT-3'