SNPJam Report for CDK6

Showing coding SNPs for CDK6 (Gene ID: 1021)

Show all SNPs for this gene at dbSNP

This SNP viewer is in beta and your feedback is appreciated!

This SNPJam view is a snapshot of the information available at dbSNP and HapMap. It has been reformated to include the information most relevant to drug and metabolomics research.

Please note that population frequency data is updated on a nightly basis and may not be present if this gene was recently annotated.

Show all non-coding SNPs

[Top]

RS ID: 55860121 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
7 92244589

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_001145306 Link_out NP_001138778 Link_out 3 T [Thr] / T [Thr]
coding-synonymous NM_001259 Link_out NP_001250 Link_out 3 T [Thr] / T [Thr]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GAGGGGGACCCATAAGCCACCAAGGGTGTTCTCCGCAGGATCAGCTTAAGGCGGCTGCTGAGGCCTCAGGCTGTATTCAGCTCCGAG
GTGTTCTGGCTGGGCGGCAGGTGGGAATCCAGGTTTTCTTTGCACCTTTCCAGGTCCTGGAAGTATGGGTGAGACAGGGCACTGTAGGCA
GATATTCTTTTGGCTGGGTTAAA C/T GTCAAACACTTCTGTAATAAAGAAAAAAATAATTGGTTGATATACAATACATCAATGTAAAT
AATGTACTTACAGAGTTATCCCTTTATTCACTGTCATATGTTAAGCGCATCTACAGTGGGAATGAGTATTTATTTAAAGGGACACTAAAT
AATATGGAGACAGTACTCATATATATCCCTAATGTATAAAATGTCCCT-3'

[Top]

RS ID: 35654944 Link_out

Alleles: C/T

Validation:

  • By frequency
  • By cluster

Details:

Chromosome Reference Position
7 92404051

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_001145306 Link_out NP_001138778 Link_out 1 D [Asp] / N [Asn]
missense NM_001259 Link_out NP_001250 Link_out 1 D [Asp] / N [Asn]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GAATATATCCCAATCTTTGAACATTTTCTTTGATTTTTTTAACTATATACCGAATTCTAAAAGTTGTAATTGTGGCAATTTTCATAA
GGAAAGAAAGCCATTGCTTAACAGACTATAATAGTCGACTGCCTGATAAGACATGAAGATGATTCTTGATACCTTTATGGTTTCAGTGGG
CACTCCAGGCTCTGGAACTTTAT C/T CAAGTAAGTGGTCAAGTCTTGATCGACATGTTCAAACACTAAAGTTAGTTTGGTTTCTCTGT
CTGTTCGTGACACTGTGCACACATCAAACAACCTAGAAGAAAAAACAAAGAGGTTAAGTAGGTGGCAATAAGCAAAGAAGTAACCTGTAT
GTTTTATACATATCGCTCAATTTGGTCTCATAATAGAAAAAAAAGGCC-3'

[Top]

RS ID: 34257565 Link_out

Alleles: A/T

Validation:

  • By frequency
  • By cluster

Details:

Chromosome Reference Position
7 92355033

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_001145306 Link_out NP_001138778 Link_out 3 P [Pro] / P [Pro]
coding-synonymous NM_001259 Link_out NP_001250 Link_out 3 P [Pro] / P [Pro]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CTTTCATTAATAAAATACAGGTTGAGAGTGAAATTTTTTGCAGTGTTCTTGAAAGTGTGGGAGTGGAAAGGCAGGAAGGGAGACAAT
TCACTCATTCAGCCAATACCTGTCAAATGCCTGCCGCATGCCAAGCAGCCACAAAATGCTAAGGATTCGGCGTCCAGCATAGCAAATGCT
CAACTTCCGTTTTGAGTGTTTACTGATTTTCTTTTTTTAATTTTATTAGGATATGATGTTTCAGCTTCTCCGAGGTCTGGACTTTCTTCA
TTCACACCGAGTAGTGCATCGCGATCTAAAACC A/T CAGAACATTCTGGTGACCAGCAGCGGACAAATAAAACTCGCTGACTTCGGCC
TTGCCCGCATCTATAGTTTCCAGATGGCTCTAACCTCAGTGGTGAGTGAGAGAGTGCTGTCCTTTTATTAAACTTATTTTTCCTATTTTG
AATGACAGTCTGTCCCTCTTCCATGTCTCTAATGTTAGTACTGCCCATGACTAGTTGGTGGATAGAATGTCTTTGCCCATTTTTATATGG
CAGTGGGTAGGCAGAAAGCATTCTGCTTACAGCTACAGTCACATCCAGCCTGGGCTTGTTGTGGACAG-3'

[Top]

RS ID: 5885815 Link_out

Alleles: -/C

Validation:

Not Completed

Details:

Chromosome Reference Position
7 92465765

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
frameshift XM_001717849 Link_out XP_001717901 Link_out 1 Not Applicable
intron NM_001145306 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CTCCAGCATGGAGTCCCTAGAGGCAGTGCATTTTAAACCCTAAATGTGAATTATTATGTGAGTGTCCGAGTAGAGTTCCAGTTCCGT
TTGGAGAAACTGTATGAGGCGTGTTCCGTGTGGGTGTGTGTGCGTACGGATACGTGGAAGCAGGATCTCGGTGTCGCGGGTGTCCCTAGG
CTGGGATCTCCCCCTCTCATCAGATAAGGAGAATCCTCTAGCTCCCCAAAACTGGCCCCCATAACCAATCCCGTCTCAGTTCGTAAGGGG
TTAACCAAAGCCGATTCCAAGGAAACACAGGTCCCCCCCACCCCCCGCCACCCTCCACTTACCCCACCCACAGTTCTGCCTCGGACCCCG
GCCAATCCCCCAGATCTCCCCCGGGACCCCCCACCCCGCAGCC -/C ACCCACCCGAGCGCACAGCTCCTCACCTGAGGGGCCCAGTCG
CGTCGGGCCTCCCGAGGGGGCTGCGAGTGTCAGTCGGCTCTCCGCACGTGTCCGCGGCCTCGCGGAGCAGGTAATCAGACTCTGGGGAAG
GAGTTACCAGCACTCTCTCCGGCGAGGGGGTGGGCACAGCGGCGGAGGGCGGAGGGACGGCGGAgggcgccgcccgcgccgctcgctggg
ggcggacgggggccgctgggctccggccggcgctgggggccccagccggggAGGCAGCTGGGGCGACCGTGCGGGGTGGGGGCAGGGACC
CGCGAAGCCAACTCTGCCGGAGACCCACCCCCCGGCGGGGCTGGGGGCTCGTGGCGCAGTGGCAAGAAAGTGTGCAAATTAAAGCCTT-3
'