SNPJam Report for C1QC

Showing coding SNPs for C1QC (Gene ID: 714)

Show all SNPs for this gene at dbSNP

This SNP viewer is in beta and your feedback is appreciated!

This SNPJam view is a snapshot of the information available at dbSNP and HapMap. It has been reformated to include the information most relevant to drug and metabolomics research.

Please note that population frequency data is updated on a nightly basis and may not be present if this gene was recently annotated.

Show all non-coding SNPs

[Top]

RS ID: 1052042 Link_out

Alleles: A/G

Validation:

  • By hap map

Details:

Chromosome Reference Position
1 22973983

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_172369 Link_out NP_758957 Link_out 1 G [Gly] / R [Arg]
missense NM_001114101 Link_out NP_001107573 Link_out 1 G [Gly] / R [Arg]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CTGCACCCAACAGCCTGATCAGATTCAACGCGGTCCTCACCAACCCGCAG A/G GAGATTATGACACGAGCACTGGCAAGTTCACC
TGCAAAGTCCCCGGCCTC-3'