SNPJam Report for ANG

Showing coding SNPs for ANG (Gene ID: 283)

Show all SNPs for this gene at dbSNP

This SNP viewer is in beta and your feedback is appreciated!

This SNPJam view is a snapshot of the information available at dbSNP and HapMap. It has been reformated to include the information most relevant to drug and metabolomics research.

Please note that population frequency data is updated on a nightly basis and may not be present if this gene was recently annotated.

Show all non-coding SNPs

[Top]

RS ID: 34277749 Link_out

Alleles: -/T

Validation:

Not Completed

Details:

Chromosome Reference Position
14 21161930

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
frameshift NM_001097577 Link_out NP_001091046 Link_out 3 F [Phe] / F [Phe]
frameshift NM_001145 Link_out NP_001136 Link_out 3 F [Phe] / F [Phe]
intron NM_002937 Link_out Not Applicable Not Applicable Not Applicable
intron NM_194431 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-CAAAGCTCCTGTCCTTTTGGCCTAATTTGGTGATGCTGTTCTTGGGTCTACCACACCTCCTTTTGCCCTCCGCAGGAGCCTGTGTTG
GAAGAGATGGTGATGGGCCTGGGCGTTTTGTTGTTGGTCTTCGTGCTGGGTCTGGGTCTGACCCCACCGACCCTGGCTCAGGATAACTCC
AGGTACACACACTTCCTGACCCAGCACTATGATGCCAAACCACAGGGCCGGGATGACAGATACTGTGAAAGCATCATGAGGAGACGGGGC
CTGACCTCACCCTGCAAAGACATCAACACATTT -/T ATTCATGGCAACAAGCGCAGCATCAAGGCCATCTGTGAAAACAAGAATGGAA
ACCCTCACAGAGAAAACCTAAGAATAAGCAAGTCTTCTTTCCAGGTCACCACTTGCAAGCTACATGGAGGTTCCCCCTGGCCTCCATGCC
AGTACCGAGCCACAGCGGGGTTCAGAAACGTTGTTGTTGCTTGTGAAAATGGCTTACCTGTCCACTTGGATCAGTCAATTTTCCGTCGTC
CGTAACCAGCGGGCCCCTGGTCAAGTGCTGGCTCTGCTGTCCTTGCCTTCCATTTCCCCTCTGCACCC-3'

[Top]

RS ID: 11541242 Link_out

Alleles: C/T

Validation:

  • By hap map

Details:

Chromosome Reference Position
14 21161899

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
intron NM_002937 Link_out Not Applicable Not Applicable Not Applicable
intron NM_194431 Link_out Not Applicable Not Applicable Not Applicable
missense NM_001097577 Link_out NP_001091046 Link_out 2 L [Leu] / P [Pro]
missense NM_001145 Link_out NP_001136 Link_out 2 L [Leu] / P [Pro]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GATAACTCCAGGTACACACACTTCCTGACCCAGCACTATGATGCCAAACCACAGGGCCGGGATGACAGATACTGTGAAAGCATCATG
AGGAGACGGGGCC C/T GACCTCACCCTGCAAAGACATCAACACATTTATTCATGGCAACAAGCGCAGCATCAAGGCCATCTGTGAAAA
CAAGAATGGAAACCCTCACAGAGAAAA-3'

[Top]

RS ID: 2228653 Link_out

Alleles: A/T

Validation:

  • By frequency
  • By cluster

Details:

Chromosome Reference Position
14 21162086

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_001097577 Link_out NP_001091046 Link_out 3 T [Thr] / T [Thr]
coding-synonymous NM_001145 Link_out NP_001136 Link_out 3 T [Thr] / T [Thr]
intron NM_002937 Link_out Not Applicable Not Applicable Not Applicable
intron NM_194431 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AGGAGACGGGGCCTGACCTCACCCTGCAAAGACATCAACACATTTATTCATGGCAACAAGCGCAGCATCAAGGCCATCTGTGAAAAC
AAGAATGGAAACCCTCACAGAGAAAACCTAAGAATAAGCAAGTCTTCTTTCCAGGTCACCACTTGCAAGCTACATGGAGGTTCCCCCTGG
CCTCCATGCCAGTACCGAGCCAC A/T GCGGGGTTCAGAAACGTTGTTGTTGCTTGTGAAAATGGCTTACCTGTCCACTTGGATCAGTC
AATTTTCCGTCGTCCGTAACCAGCGGGCCCCTGGTCAAGTGCTGGCTCTGCTGTCCTTGCCTTCCATTTCCCCTCTGCACCCAGAACAGT
GGTGGCAACATTCATTGCCAAGGGCCCAAAGAAAGAGCTACCTGGACC-3'

[Top]

RS ID: 17560 Link_out

Alleles: A/G

Validation:

  • By frequency
  • By cluster

Details:

Chromosome Reference Position
14 21161973

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
intron NM_002937 Link_out Not Applicable Not Applicable Not Applicable
intron NM_194431 Link_out Not Applicable Not Applicable Not Applicable
missense NM_001097577 Link_out NP_001091046 Link_out 1 K [Lys] / E [Glu]
missense NM_001145 Link_out NP_001136 Link_out 1 K [Lys] / E [Glu]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TGAAAGCATCATGAGGAGACGGGGCCTGACCTCACCCTGCAAAGACATCAACACATTTATTCATGGCAACAAGCGCAGCATCAAGGC
CATCTGTGAAAAC A/G AGAATGGAAACCCTCACAGAGAAAACCTAAGAATAAGCAAGTCTTCTTTCCAGGTCACCACTTGCAAGCTAC
ATGGAGGTTCCCCCTGGCCTCCATGCCA-3'

[Top]

RS ID: 11701 Link_out

Alleles: G/T

Validation:

  • By frequency
  • By cluster

Details:

Chromosome Reference Position
14 21162053

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_001097577 Link_out NP_001091046 Link_out 3 G [Gly] / G [Gly]
coding-synonymous NM_001145 Link_out NP_001136 Link_out 3 G [Gly] / G [Gly]
intron NM_002937 Link_out Not Applicable Not Applicable Not Applicable
intron NM_194431 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-GGCCGGGATGACAGATACTGTGAAAGCATCATGAGGAGACGGGGCCTGACCTCACCCTGCAAAGACATCAACACATTTATTCATGGC
AACAAGCGCAGCATCAAGGCCATCTGTGAAAACAAGAATGGAAACCCTCACAGAGAAAACCTAAGAATAAGCAAGTCTTCTTTCCAGGTC
ACCACTTGCAAGCTACATGGAGG G/T TCCCCCTGGCCTCCATGCCAGTACCGAGCCACAGCGGGGTTCAGAAACGTTGTTGTTGCTTG
TGAAAATGGCTTACCTGTCCACTTGGATCAGTCAATTTTCCGTCGTCCGTAACCAGCGGGCCCCTGGTCAAGTGCTGGCTCTGCTGTCCT
TGCCTTCCATTTCCCCTCTGCACCCAGAACAGTGGTGGCAACATTCAT-3'