SNPJam Report for ACADM

Showing coding SNPs for ACADM (Gene ID: 34)

Show all SNPs for this gene at dbSNP

This SNP viewer is in beta and your feedback is appreciated!

This SNPJam view is a snapshot of the information available at dbSNP and HapMap. It has been reformated to include the information most relevant to drug and metabolomics research.

Please note that population frequency data is updated on a nightly basis and may not be present if this gene was recently annotated.

Show all non-coding SNPs

[Top]

RS ID: 2229249 Link_out

Alleles: A/G

Validation:

  • By submitter

Details:

Chromosome Reference Position
1 76211569

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_001127328 Link_out NP_001120800 Link_out 3 A [Ala] / A [Ala]
coding-synonymous NM_000016 Link_out NP_000007 Link_out 3 A [Ala] / A [Ala]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AGAAAAGAAAGGAGATGAGTATATTATTAATGGTCAGAAGATGTGGATAACCAACGGAGGAAAAGCTAATTGGTATTTTTTATTGGC
ACGTTCTGATCCAGATCCTAAAGCTCCTGCTAATAAAGCCTTTACTGGATTCATTGTGGAAGC A/G GATACCCCAGGAATTCAGATTG
GGAGAAAGGAATTAAACATGGGCCAGCGATGTTCAGATACTAGAGGAATTGTCTTCGAAGATGTGAAAGTGCCTAAAGAAAATGTTTTAA
TTGGTGACGGAGCTGGTTTCAAAGTTGCAATGGGAGCT-3'

[Top]

RS ID: 1061337 Link_out

Alleles: A/G

Validation:

  • By frequency
  • By submitter
  • By cluster

Details:

Chromosome Reference Position
1 76227022

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
coding-synonymous NM_001127328 Link_out NP_001120800 Link_out 3 V [Val] / V [Val]
coding-synonymous NM_000016 Link_out NP_000007 Link_out 3 V [Val] / V [Val]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TCACTATAAAAATGAAAAAGCCCCAGGAAAAAACTTTTAAGTTTTCTCAATAAATATCCTTTAATTTTTTTCTTTTTAATTCTAGCA
CCAAGCAATATCATTTATGCTGGCTGAAATGGCAATGAAAGTTGAACTAGCTAGAATGAGTTACCAGAGAGCAGCTTGGGAGGTTGATTC
TGGTCGTCGAAATACCTATTATGCTTCTATTGCAAAGGCATTTGCTGGAGATATTGCAAATCAGTTAGCTACTGATGCTGTGCAGATACT
TGGAGGCAATGGATTTAATACAGAATATCCTGT A/G GAAAAACTAATGAGGGATGCCAAAATCTATCAGGTAAGGTTAAAGATGATTT
TTTTGGTTTGCAAGGAGAGAGAATATTCATAAATGACAACGTGGATTTCTGATTATTTAGAAATTTTATGTCCCTAGTAGCAATAAATGA
CTGTCATATATGGCTGTGAGCCAGTTTTTGGAATTAATTAATAGAAAGAAGAATGTTATTTGTGATTAAGTATAAGTCTGAAGAGAGAAT
AGGCTAAAAAAAATGGTACAGACATGTGTATTACGTTTGGATTAGATTTCTTTGAGTTTTAACAGATT-3'

[Top]

RS ID: 398123075 Link_out

Alleles: A/G

Validation:

Not Completed

Details:

Chromosome Reference Position
1 75732889

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_001127328 Link_out NP_001120800 Link_out 1 G [Gly] / S [Ser]
missense NM_000016 Link_out NP_000007 Link_out 1 G [Gly] / S [Ser]
missense NM_001286042 Link_out NP_001272971 Link_out 1 G [Gly] / S [Ser]
missense NM_001286043 Link_out NP_001272972 Link_out 1 G [Gly] / S [Ser]
utr-variant-5-prime NM_001286044 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-TCTTTTTCTTCTAGTATCCAGTCCCCCTAATTAGAAGAGCCTGGGAACTT A/G GTTTAATGAACACACACATTCCAGAGAACTGT
GGTAAGCTTTCTTTATAT-3'

[Top]

RS ID: 398123074 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
1 75732869

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_001127328 Link_out NP_001120800 Link_out 2 I [Ile] / T [Thr]
missense NM_000016 Link_out NP_000007 Link_out 2 I [Ile] / T [Thr]
missense NM_001286042 Link_out NP_001272971 Link_out 2 I [Ile] / T [Thr]
missense NM_001286043 Link_out NP_001272972 Link_out 2 I [Ile] / T [Thr]
utr-variant-5-prime NM_001286044 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AAAATATATTTTAACTCAGTTCTTTTTCTTCTAGTATCCAGTCCCCCTAA C/T TAGAAGAGCCTGGGAACTTGGTTTAATGAACA
CACACATTCCAGAGAACT-3'

[Top]

RS ID: 398123072 Link_out

Alleles: C/T

Validation:

Not Completed

Details:

Chromosome Reference Position
1 75732682

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
missense NM_001127328 Link_out NP_001120800 Link_out 1 R [Arg] / C [Cys]
missense NM_000016 Link_out NP_000007 Link_out 1 R [Arg] / C [Cys]
missense NM_001286042 Link_out NP_001272971 Link_out 1 R [Arg] / C [Cys]
missense NM_001286043 Link_out NP_001272972 Link_out 1 R [Arg] / C [Cys]
utr-variant-5-prime NM_001286044 Link_out Not Applicable Not Applicable Not Applicable

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-ATTTTCCCTTAGAGTTCACCGAACAGCAGAAAGAATTTCAAGCTACTGCT C/T GTAAATTTGCCAGAGAGGAAATCATCCCAGTG
GCTGCAGAATATGATAAA-3'

[Top]

RS ID: 398123071 Link_out

Alleles: C/G

Validation:

Not Completed

Details:

Chromosome Reference Position
1 75728488

Function Class mRNA Accession Protein Accession Reading Frame Amino Acids
intron-variant NM_001286042 Link_out Not Applicable Not Applicable Not Applicable
intron-variant NM_001286044 Link_out Not Applicable Not Applicable Not Applicable
missense NM_001127328 Link_out NP_001120800 Link_out 1 E [Glu] / Q [Gln]
missense NM_000016 Link_out NP_000007 Link_out 1 E [Glu] / Q [Gln]
missense NM_001286043 Link_out NP_001272972 Link_out 1 E [Glu] / Q [Gln]

Source: dbSNP

Population Frequencies:

Not Completed

Sequence:

5'-AGCATACAAAAGCCAATCGACAACGTGAACCAGGATTAGGATTTAGTTTT C/G GTATATGTTCGGTTCTATCTTTTGACTTTAAA
CTTATACATATGAAGCTT-3'